Scolaris Content Display Scolaris Content Display

Trasplante fecal para el tratamiento de la enfermedad inflamatoria intestinal

Contraer todo Desplegar todo

Antecedentes

La enfermedad inflamatoria intestinal (EII) es una enfermedad crónica y recurrente del tracto gastrointestinal (GI) que se cree que está asociada a una compleja interacción entre el sistema inmunitario, el revestimiento del tracto GI, el medio ambiente y el microbioma intestinal, lo que da lugar a una respuesta inflamatoria anormal en individuos genéticamente susceptibles. Una composición alterada de la microbiota nativa del intestino, conocida como disbiosis, puede tener una función importante en la patogénesis de la colitis ulcerosa (CU) y la enfermedad de Crohn (EC), dos subtipos de EII. Existe un interés creciente en la corrección de esta disbiosis subyacente mediante el trasplante de microbiota fecal (TMF).

Objetivos

Evaluar los efectos beneficiosos y el perfil de seguridad del TMF para el tratamiento de la EII en adultos y niños versus el TMF autólogo, placebo, medicación estándar o ninguna intervención.

Métodos de búsqueda

Se realizaron búsquedas en CENTRAL, MEDLINE, Embase, dos registros de ensayos clínicos y las secciones de referencias de los ensayos publicados hasta el 22 de diciembre de 2022.

Criterios de selección

Se incluyeron ensayos controlados aleatorizados que estudiaron adultos y niños con CU o EC. Los grupos de intervención elegibles utilizaron el TMF, definido como la administración de heces sanas de un donante que contienen microbiota intestinal al tracto gastrointestinal de un receptor, para tratar la CU o la EC.

Obtención y análisis de los datos

Dos autores de la revisión de forma independiente examinaron los estudios para inclusión. Los desenlaces principales fueron: 1. inducción de la remisión clínica, 2. mantenimiento de la remisión clínica, y 3. eventos adversos graves. Los desenlaces secundarios fueron: 4. cualquier evento adverso, 5. remisión endoscópica, 6. calidad de vida, 7. respuesta clínica, 8. respuesta endoscópica, 9. retiros, 10. marcadores inflamatorios y 11. desenlaces del microbioma. Se utilizó el método GRADE para evaluar la certeza de la evidencia.

Resultados principales

Se incluyeron 12 estudios con 550 participantes: Se realizaron tres estudios en Australia, dos en Canadá y uno en cada uno de los siguientes países: China, EE. UU., Francia, India, Países Bajos y República Checa. Un estudio se realizó en Israel y en Italia. El TMF se administró en forma de cápsulas o suspensiones y se administró por vía oral, sonda nasoduodenal, enema o colonoscopia. Un estudio administró TMF en cápsulas orales y mediante colonoscopia. Seis estudios tuvieron un riesgo general de sesgo bajo, mientras que los demás tuvieron un riesgo de sesgo incierto o alto.

Diez estudios con 468 participantes, de los cuales nueve se centraron en adultos y uno en niños, informaron la inducción de la remisión clínica en personas con CU en el seguimiento más prolongado (intervalo de seis a 12 semanas) y mostraron que el TMF podría aumentar las tasas de inducción de la remisión clínica en la CU en comparación con el control (razón de riesgos [RR] 1,79; intervalo de confianza [IC] del 95%: 1,13 a 2,84; evidencia de certeza baja). Cinco estudios mostraron que el TMF podría aumentar las tasas de inducción de la remisión endoscópica en la CU en el seguimiento más prolongado (intervalo de ocho a 12 semanas); sin embargo, los IC alrededor de la estimación resumida fueron amplios e incluyeron un posible efecto nulo (RR 1,45; IC del 95%: 0,64 a 3,29; evidencia de certeza baja). Nueve estudios con 417 participantes mostraron que el TMF podría dar lugar a poca o ninguna diferencia en las tasas de cualquier evento adverso (RR 0,99; IC del 95%: 0,85 a 1,16; evidencia de certeza baja). La evidencia acerca del riesgo de eventos adversos graves (RR 1,77; IC del 95%: 0,88 a 3,55; evidencia de certeza muy baja) y la mejoría en la calidad de vida (diferencia de medias [DM] 15,34; IC del 95%: ‐3,84 a 34,52; evidencia de certeza muy baja) cuando se utilizó el TMF para inducir la remisión en la CU fue muy incierta.

Dos estudios, de los cuales uno también proporcionó datos para la inducción de la remisión en la CU activa, evaluaron el mantenimiento de la remisión en personas con CU controlada en el seguimiento más largo (intervalo de 48 a 56 semanas). Fue muy incierta la evidencia sobre el uso del TMF para el mantenimiento de la remisión clínica (RR 2,97; IC del 95%: 0,26 a 34,42; evidencia de certeza muy baja) y la remisión endoscópica (RR 3,28; IC del 95%: 0,73 a 14,74; evidencia de certeza muy baja). La evidencia acerca del riesgo de eventos adversos graves, el riesgo de cualquier evento adverso y la mejoría en la calidad de vida cuando se utilizó el TMF para mantener la remisión en la CU también fue muy incierta.

Ninguno de los estudios incluidos evaluó el uso del TMF para la inducción de la remisión en personas con EC.

Un estudio con 21 participantes proporcionó datos sobre el TMF para el mantenimiento de la remisión en personas con EC. La evidencia acerca del uso del TMF para el mantenimiento de la remisión clínica en la EC a las 24 semanas fue muy incierta (RR 1,21; IC del 95%: 0,36 a 4,14; evidencia de certeza muy baja). La evidencia sobre el riesgo de eventos adversos graves o de cualquier tipo cuando se utilizó el TMF para mantener la remisión en la EC también fue muy incierta. Ninguno de los estudios proporcionó datos sobre el uso del TMF para el mantenimiento de la remisión endoscópica o la mejoría de la calidad de vida en personas con EC.

Conclusiones de los autores

El TMF podría aumentar la proporción de personas con CU activa que alcanzan la remisión clínica y endoscópica. La evidencia acerca de si el uso de TMF en personas con CU activa repercutió en el riesgo de eventos adversos graves o en la mejoría de la calidad de vida fue muy incierta. La evidencia sobre el uso del TMF para el mantenimiento de la remisión en personas con CU, así como la inducción y el mantenimiento de la remisión en personas con EC, también fue muy incierta, y no fue posible hacer afirmaciones concluyentes al respecto. Se necesitan más estudios para abordar los efectos beneficiosos y el perfil de seguridad del TMF en adultos y niños con CU y EC activas, así como su potencial para promover el mantenimiento de la remisión a más largo plazo en la CU y la EC.

PICO

Population
Intervention
Comparison
Outcome

El uso y la enseñanza del modelo PICO están muy extendidos en el ámbito de la atención sanitaria basada en la evidencia para formular preguntas y estrategias de búsqueda y para caracterizar estudios o metanálisis clínicos. PICO son las siglas en inglés de cuatro posibles componentes de una pregunta de investigación: paciente, población o problema; intervención; comparación; desenlace (outcome).

Para saber más sobre el uso del modelo PICO, puede consultar el Manual Cochrane.

Trasplante fecal para el tratamiento de la enfermedad inflamatoria intestinal

Mensajes clave

‐ La colitis ulcerosa (CU) y la enfermedad de Crohn (EC) son dos formas de enfermedad inflamatoria intestinal (EII). La EII es una enfermedad autoinmune que afecta al intestino, ya que el sistema inmunitario del cuerpo ataca por error a las células, tejidos y órganos sanos.

• El trasplante fecal podría aumentar la proporción de personas con CU activa que logran el control de la enfermedad, definido como remisión clínica (control de la enfermedad definido en función de los síntomas clínicos) y remisión endoscópica (control de la enfermedad definido en función de los hallazgos endoscópicos), y podría tener poco o ningún efecto sobre las tasas de cualquier episodio adverso (episodios no deseados que causan daño a la persona).

‐ La evidencia fue muy incierta acerca del riesgo de eventos adversos graves y la mejoría en la calidad de vida cuando se utilizó el trasplante fecal para el control de la CU activa.

• La evidencia acerca del uso del trasplante fecal para la inducción de la remisión en personas con EC activa y el mantenimiento de la remisión en personas con CU o EC también fue muy incierta.

• El trasplante fecal es un tratamiento en evolución y se necesitan más estudios para evaluar sus beneficios y riesgos en adultos y niños con CU o EC activas, así como su posible uso para el control a largo plazo de la CU y la EC.

¿Qué es la enfermedad inflamatoria intestinal?

La CU y la EC son dos formas de EII que pueden causar pérdida de peso, dolor abdominal y pérdida de sangre debido a la inflamación (dolor e hinchazón) del tracto gastrointestinal (GI), y que afectan a unos 6 800 000 personas en todo el mundo. Aún no se han determinado las razones exactas por las que las personas desarrollan EII, pero se cree que implican una compleja interacción entre el sistema inmunitario, el revestimiento del tracto gastrointestinal, el medio ambiente y el microbioma intestinal, que conduce a una respuesta inflamatoria anormal en individuos genéticamente susceptibles. La evidencia indica que una composición poco saludable de la microbiota intestinal se asocia con el desarrollo de EII, y su corrección puede ayudar a controlar la inflamación observada en la EII. La administración de heces de un donante sano al paciente, denominada trasplante de microbiota fecal (TMF), podría restablecer un equilibrio saludable de la microbiota intestinal y controlar la inflamación relacionada con la EII en la enfermedad activa (lo que se denomina inducción de la remisión) y a largo plazo (lo que se denomina mantenimiento de la remisión).

¿Qué se quería averiguar?

Se deseaba evaluar los beneficios y los riesgos del TMF para el tratamiento de la EII (CU y EC).

¿Qué se hizo?

Se realizaron búsquedas en múltiples bases de datos de ensayos controlados aleatorizados (ECA), un diseño de estudio considerado superior para la evaluación de intervenciones clínicas, que compararan el TMF con los tratamientos control para la EII. Cuando fue posible se combinaron los datos de múltiples estudios y la confianza en la evidencia se calificó en base a factores como la metodología del estudio, el conocimiento de los participantes sobre el tratamiento recibido y el tamaño de las muestras.

¿Qué se encontró?

Diez estudios (nueve en adultos y uno en niños) mostraron que el TMF podría aumentar las tasas de inducción de la remisión clínica y la remisión endoscópica y podría dar lugar a poca o ninguna diferencia en las tasas de cualquier episodio adverso en personas con CU activa. Los datos sobre el riesgo de episodios adversos graves y la mejoría de la calidad de vida no estuvieron claros, y no fue posible establecer conclusiones con respecto a estos desenlaces.

Dos estudios proporcionaron datos sobre el uso del TMF para el mantenimiento de la remisión en adultos con CU controlada. En general, la evidencia acerca del uso del TFM para mantener la remisión clínica o endoscópica en la CU controlada, así como sobre el riesgo asociado de eventos adversos y la mejoría en la calidad de vida fue muy incierta.

Ninguno de los estudios incluidos proporcionó datos sobre el uso del TMF para el control de la EC activa.

Un estudio proporcionó datos sobre el uso del TMF para el mantenimiento de la remisión en adultos con EC controlada, y la evidencia sobre los beneficios y los riesgos del TMF cuando se utiliza para mantener la remisión clínica en la EC controlada fue muy incierta.

Los estudios variaron en cuanto a los métodos, dosis y frecuencias de administración del TMF, así como en los tipos de donantes y la gravedad inicial de la enfermedad. Los métodos de administración del TMF incluyeron cápsulas orales, sonda nasoduodenal (un tubo que pasa a través de la nariz hasta el intestino delgado a través del estómago), enema rectal, colonoscopia (un tubo que se introduce en el colon a través del ano) y combinaciones de estos métodos.

¿Cuáles son las limitaciones de la evidencia?

La confianza en la evidencia fue limitada debido al escaso número de participantes, las dudas sobre cómo se realizaron los estudios y las variaciones del efecto entre los estudios en algunos de los análisis. Se necesitan estudios adicionales para abordar los beneficios y riesgos del TMF en adultos y niños con EII.

¿Cuál es el grado de actualización de esta evidencia?

Esta revisión es una actualización de la revisión anterior que se publicó en 2018. La evidencia está actualizada hasta el 22 de diciembre de 2022.

Authors' conclusions

Implications for practice

Fecal microbiota transplantation (FMT) may increase the proportion of people with mild‐to‐moderate active ulcerative colitis (UC) who achieve clinical and endoscopic remission with little to no difference in any adverse events. The evidence was very uncertain about the risk of serious adverse events or improvement in quality of life when FMT was used for induction of remission in active UC. The evidence was also very uncertain about the use of FMT for maintenance of remission in both UC and Crohn disease (CD), and no conclusive statements could be made in this regard. We found no randomized trials on use of FMT for induction of remission in CD.

Implications for research

Additional studies are needed to further assess the use of FMT for treatment of UC and CD, especially in people with severe disease, as most studies in this review assessed the use of FMT for induction of remission in adults with mild‐to‐moderate UC. Only one small study assessed the use of FMT to treat UC in children, so more studies are needed in the pediatric population as well. Further evaluations of the microbiome and metabolome are also needed to establish the exact mechanism of action of FMT in treatment of inflammatory bowel disease (IBD). It is important to note that the composition of human microbiota is highly heterogeneous with high interindividual variability. Thus, more in‐depth analyses exploring the functional impact of FMT on the microbiota of people with IBD are needed. Furthermore, the included studies did not explore other components of the microbiome such as the virome or fungome, which have been recently appreciated as important factors in health and disease (Carding 2017Witherden 2017). Also, it is unclear whether non‐microbial components of stool, such as bile acids, have any impact on treatment outcomes. Finally, socioeconomic status and other barriers to participation in clinical trials could potentially bias the population that is enrolled and studied. Future clinical trials on the use of FMT for treatment of IBD should try to recruit a diverse and representative population. However, we acknowledge that it is very challenging to recruit people into studies in which the intervention needs an extensive regulatory process, such as FMT. Multiple factors make enrollment of a diverse sample challenging in the USA, such as distrust among African‐American communities towards academic research (Nooruddin 2020), language barriers among immigrant communities (Nageswaran 2022), and poor access to health care among Native‐American and rural communities (Ghebre 2014). We hope that the data synthesized in this Cochrane Review will help future research in creating an 'evidence‐based' study design to take full advantage of the efforts to recruit participants into FMT trials.

The strongest evidence for use of FMT comes from its use in the treatment of recurrent Clostridioides difficile infection (rCDI), in which a single dose from a single donor might be effective in about 60% to 80% of patients, and the proportion increases to over 90% with follow‐up treatment in those who did not respond to the first treatment (Cammarota 2015Cammarota 2017Kelly 2021). The characteristics of FMT administration for treatment of IBD might be different from those for treatment of rCDI. For example, the two largest studies in this review, which showed promising results, used stool from multiple donors and their frequency of administration ranged from three times in an eight‐week period (Costello 2019) to 40 times in an eight‐week period (Paramsothy 2017). Further data are needed to delineate aspects of FMT use for treatment of IBD in terms of route (upper versus lower gastrointestinal tract), frequency, type of donor (single versus pooled), timing (primary induction versus rescue therapy), preparation of stool (aerobic versus anaerobic; frozen versus fresh), and duration of therapy (for induction of remission). Another important aspect to assess in use of FMT is whether it can be used as an adjuvant therapy to increase the rates of induction of remission and to avoid treatment failures such as development of antibodies to biologics.

The use of FMT for maintenance of remission in UC and CD might pose unique challenges related to long‐term safety of this intervention. Data from observational studies indicate that a single dose of FMT may change the microbiome and have long‐term effects including the risk of developing chronic diseases (Alang 2015Saha 2021). Similarly, each dose of FMT may increase the risk of transmission of infection, and this risk might increase significantly in the setting of multiple doses given over longer periods of time. Thus, future studies that aim to evaluate the use of FMT for maintenance of remission in UC or CD should plan for long‐term follow‐up of these patients to assess for any adverse effects with long‐term consequences.

We noted 29 ongoing studies that reflect the scientific community's interest in investigating the role of FMT for treatment of IBD (see Characteristics of ongoing studies table). However, we anticipate challenges with adoption and conduct of this intervention as a 'drug' in clinical practice due to variation in production and quality control of each FMT specimen. The US Food and Drug Administration (FDA) has issued guidelines to help with appropriate development of FMT‐based products used in clinical studies, and the guidance includes information on donor screening and blood testing, stool testing, as well as appropriate preparation and administration of the FMT product (Carlson 2020). The FDA also emphasized the need to develop potency assays of the FMT product and perform stability studies to ensure that individual species within the product's microbiota are viable and to assess any potential impact of the donor microbiome on the product's safety and effectiveness (Carlson 2020). There is also growing interest in other microbiome‐based therapies, such as modified stool products that may reduce the concentration of potentially harmful bacteria (Feuerstadt 2022), and the administration of laboratory‐grown bacteria without using any stool product (Rode 2021) for treatment of rCDI. Future studies may focus on some of these newer microbiome‐based therapies to investigate their role in the treatment of IBD.

Summary of findings

Open in table viewer
Summary of findings 1. Fecal microbiota transplantation compared to control for induction of remission in ulcerative colitis

Patient or population: people with active UC

Setting: inpatient or outpatient

Intervention: FMT

Comparison: control

Outcome

Anticipated absolute effects* (95% CI)

Relative effect (95% CI)

№ of participants
(studies)

Certainty of the evidence

What happens

Risk with control

Risk with FMT

Induction of clinical remission in UC at longest follow‐up (RR > 1 favors FMT)
Follow‐up: range 6–12 weeks

174 per 1000

312 per 1000
(197 to 494)

RR 1.79
(1.13 to 2.84)

468
(10 RCTs)

⊕⊕⊖⊖
Lowa,b,c

FMT may increase induction of clinical remission in UC at longest follow‐up.

Serious adverse events with use of FMT for induction of remission in UC (RR > 1 favors control)
Follow‐up: range 6–12 weeks

54 per 1000

95 per 1000
(47 to 190)

RR 1.77
(0.88 to 3.55)

468
(10 RCTs)

⊕⊝⊝⊝
Very lowa,d

The evidence is very uncertain about the effect of FMT on serious adverse events in people with UC.

Any adverse events with use of FMT for induction of remission in UC (RR > 1 favors control)
Follow‐up: range 6–12 weeks

455 per 1000

450 per 1000
(386 to 527)

RR 0.99
(0.85 to 1.16)

417
(9 RCTs)

⊕⊕⊖⊖
Lowa,e

FMT may result in little to no difference in any adverse events in people with UC.

Induction of endoscopic remission in UC at longest follow‐up (RR > 1 favors FMT)
Follow‐up: range 8–12 weeks

98 per 1000

143 per 1000
(63 to 324)

RR 1.45
(0.64 to 3.29)

285
(5 RCTs)

⊕⊕⊖⊖
Lowf,g,h

FMT may result in an increase in induction of endoscopic remission in UC at longest follow‐up; however, the CIs around the summary estimate were wide and included a possibility of no effect.

Quality‐of‐life scores: IBDQ with use of FMT for induction of remission in UC (MD > 0 favors FMT)
Follow‐up: range 8–12 weeks

The mean quality of life score: IBDQ was 150 QOL‐IBDQ score in control group

MD 15.34 QOL‐IBDQ scores higher
(3.84 lower to 34.52 higher)

131
(3 RCTs)

⊕⊝⊝⊝
Very lowi,j,k

The evidence is very uncertain about the effect of FMT on quality‐of‐life scores: IBDQ in UC.

*The risk in the intervention group (and its 95% confidence interval) is based on the assumed risk in the comparison group and the relative effect of the intervention (and its 95% CI).

CI: confidence interval; FMT: fecal microbiota transplantation; IBDQ: Inflammatory Bowel Disease Questionnaire; MD: mean difference; RCT: randomized controlled trial; RR: risk ratio; UC: ulcerative colitis.

GRADE Working Group grades of evidence
High certainty: we are very confident that the true effect lies close to that of the estimate of the effect.
Moderate certainty: we are moderately confident in the effect estimate: the true effect is likely to be close to the estimate of the effect, but there is a possibility that it is substantially different.
Low certainty: our confidence in the effect estimate is limited: the true effect may be substantially different from the estimate of the effect.
Very low certainty: we have very little confidence in the effect estimate: the true effect is likely to be substantially different from the estimate of the effect.

a Downgraded one level due to risk of bias. Three studies were at high risk of bias due to lack of blinding of participants or outcome assessors. Two studies had significant attrition.
b Not downgraded for inconsistency. The direction of effect was in favor of the intervention in eight of 10 studies. I2 = 48%.
c Downgraded one level due to imprecision. We acknowledge that the overall absolute effect was 138 per 1000 or 13.8% higher for FMT, which is clinically meaningful (we considered an absolute effect of 10% to 15% as a minimally important difference); however, the CIs were wide and included an absolute effect as low as 2.3%, which might not be clinically meaningful.
d Downgraded two levels for very serious imprecision because the numbers of events were very small (total 26) and the CIs around the summary estimate were wide. The ratio of upper limit of CI to lower limit of CI exceeded four, indicating that the current pooled sample size is lower than optimal information size.
e Downgraded one level due to imprecision because the CIs around the summary estimate were wide and included a null effect.
f Not downgraded for risk of bias even though one study was at high risk of bias due to lack of allocation concealment and lack of blinding of participants; we considered these factors as less likely to cause significant risk of bias due to the objective nature of the outcome.
g Not downgraded for inconsistency (I2 = 38%).
h Downgraded two levels for very serious imprecision. Overall number of events was small and the CIs around the summary estimate were very wide.
i Not downgraded for risk of bias. Even though one study had high attrition, it was balanced between groups.
j Downgraded one level for inconsistency and I2 = 56%.
k Downgraded two levels for very serious imprecision because the CIs around the summary estimate were very wide and almost included a null effect. In addition, the ratio of upper CI to lower CI exceeded 3, indicating that optimal information size was not achieved.

Open in table viewer
Summary of findings 2. Fecal microbiota transplantation compared to control for maintenance of remission in ulcerative colitis

Patient or population: people with UC in remission

Setting: inpatient or outpatient

Intervention: FMT

Comparison: control

Outcomes

Anticipated absolute effects* (95% CI)

Relative effect
(95% CI)

№ of participants
(studies)

Certainty of the evidence
(GRADE)

What happens

Risk with control

Risk with FMT

Maintenance of clinical remission in UC (RR > 1 favors intervention)
Follow‐up: 48–56 weeks

556 per 1000

1000 per 1000
(144 to 1000)

RR 2.97
(0.26 to 34.42)

71
(2 RCTs)

⊕⊝⊝⊝
Very lowa,b,c

The evidence is very uncertain about the effect of FMT on maintenance of clinical remission in UC.

Serious adverse events with use of FMT for maintenance of remission in UC (RR > 1 favors control)
Follow‐up: 48–56 weeks

0 per 1000

0 per 1000
(0 to 0)

Not estimable

71
(2 RCTs)

⊕⊝⊝⊝
Very lowd,e

The evidence is very uncertain about the effect of FMT on serious adverse events when FMT was used for maintenance of remission in UC.

Any adverse events with use of FMT for maintenance of remission in UC (RR > 1 favors the control)
Follow‐up: 48–56 weeks

556 per 1000

644 per 1000
(472 to 883)

RR 1.16
(0.85 to 1.59)

71
(2 RCTs)

⊕⊝⊝⊝
Very lowf,g

The evidence is very uncertain about the effect of FMT on any adverse events when FMT was used for maintenance of remission in UC.

Maintenance of endoscopic remission in UC (RR > 1 favors FMT)
Follow‐up: 48–56 weeks

222 per 1000

729 per 1000
(162 to 1000)

RR 3.28
(0.73 to 14.74)

71
(2 RCTs)

⊕⊝⊝⊝
Very lowh,i,j

The evidence is very uncertain about the effect of FMT on maintenance of endoscopic remission in UC.

Quality‐of‐life scores with use of FMT for maintenance of remission in UC
Follow‐up: mean 56 weeks

The mean quality‐of‐life score was 164 in control group when FMT was used for maintenance of remission in UC

MD 38.2 IBDQ score higher
(19.3 higher to 57.1 higher)

10
(1 RCT)

⊕⊝⊝⊝
Very lowh,k

The evidence is very uncertain about the effect of FMT on quality‐of‐life scores when FMT was used for maintenance of remission in UC.

*The risk in the intervention group (and its 95% confidence interval) is based on the assumed risk in the comparison group and the relative effect of the intervention (and its 95% CI).

CI: confidence interval; FMT: fecal microbiota transplantation; IBDQ: Inflammatory Bowel Disease Questionnaire; MD: mean difference; RCT: randomized controlled trial; RR: risk ratio; UC: ulcerative colitis.

GRADE Working Group grades of evidence
High certainty: we are very confident that the true effect lies close to that of the estimate of the effect.
Moderate certainty: we are moderately confident in the effect estimate: the true effect is likely to be close to the estimate of the effect, but there is a possibility that it is substantially different.
Low certainty: our confidence in the effect estimate is limited: the true effect may be substantially different from the estimate of the effect.
Very low certainty: we have very little confidence in the effect estimate: the true effect is likely to be substantially different from the estimate of the effect.

a Downgraded one level for risk of bias. One study addressed induction of clinical remission and maintenance of clinical remission (Haifer 2022). The portion of maintenance of remission was open‐label and there was significant attrition for this portion of the study.
b Downgraded one level for inconsistency. The magnitude of effect differed widely between the two studies. I2 = 72%.
c Downgraded two levels for imprecision. The number of events was small and the CIs around the summary estimate were very wide.
d Downgraded one level for risk of bias. One study was open‐label and had significant attrition when FMT was used for maintenance of remission, so the assessment of risk of serious adverse events could have been biased (Haifer 2022).
e Downgraded two levels for very serious imprecision. There were no events in either study.
f Downgraded one level for risk of bias. One study was open‐label and had significant attrition when FMT was used for maintenance of remission, so the assessment of risk of adverse events could have been biased (Haifer 2022).
g Downgraded two levels for severe imprecision. The CIs around the summary estimate were very wide.
h Downgraded one level for risk of bias. One study was open‐label and had significant attrition when FMT was used for maintenance of endoscopic remission.
i Not downgraded for inconsistency as both studies had an effect in favor of the intervention.
j Downgraded two levels for very serious imprecision. The number of events was small and CIs around the summary estimate were very wide.
k Downgraded two levels for very serious imprecision. There was a low number of participants (10) and the CIs around the summary estimate were very wide.

Open in table viewer
Summary of findings 3. Fecal microbiota transplantation compared to control for induction of remission in Crohn disease

Patient or population: people with active CD

Setting: inpatient or outpatient

Intervention: FMT

Comparison: control

Outcomes

Anticipated absolute effects* (95% CI)

Relative effect
(95% CI)

№ of participants
(studies)

Certainty of the evidence
(GRADE)

What happens

Risk with control

Risk with FMT

Induction of clinical remission in CD

Not estimable

(0 studies)

No study reported data on use of FMT for induction of clinical remission in CD.

Serious adverse events with use of FMT for induction of remission in CD

Not estimable

(0 studies)

No study reported data for serious adverse events when FMT was used for induction of remission in CD.

Any adverse events with use of FMT for induction of remission in CD

Not estimable

(0 studies)

No study reported data for any adverse events when FMT was used for induction of remission in CD.

Induction of endoscopic remission in CD

Not estimable

(0 studies)

No study reported data on use of FMT for induction of endoscopic remission in CD.

Quality‐of‐life scores with use of FMT for induction of remission in CD

Not estimable

(0 studies)

No study reported data for quality‐of‐life scores when FMT was used for induction of remission in CD.

*The risk in the intervention group (and its 95% confidence interval) is based on the assumed risk in the comparison group and the relative effect of the intervention (and its 95% CI).

CD: Crohn disease; CI: confidence interval; FMT: fecal microbiota transplantation; MD: mean difference; RR: risk ratio.

GRADE Working Group grades of evidence
High certainty: we are very confident that the true effect lies close to that of the estimate of the effect.
Moderate certainty: we are moderately confident in the effect estimate: the true effect is likely to be close to the estimate of the effect, but there is a possibility that it is substantially different.
Low certainty: our confidence in the effect estimate is limited: the true effect may be substantially different from the estimate of the effect.
Very low certainty: we have very little confidence in the effect estimate: the true effect is likely to be substantially different from the estimate of the effect.

Open in table viewer
Summary of findings 4. Fecal microbiota transplantation compared to control for maintenance of remission in Crohn disease

Patient or population: people with CD in remission

Setting: inpatient or outpatient

Intervention: FMT

Comparison: control

Outcome

Anticipated absolute effects (95% CI)

Relative effect (95% CI)

№ of participants
(studies)

Certainty of the evidence

What happens

Risk with control

Risk with FMT

Maintenance of remission in CD
Follow‐up: 24 weeks

300 per 1000

363 per 1000
(108 to 1000)

RR 1.21
(0.36 to 4.14)

21
(1 RCT)

⊕⊝⊝⊝
Very lowa,b

The evidence is very uncertain about the effect of FMT on maintenance of remission in CD.

Serious adverse events with use of FMT for maintenance of remission in CD
Follow‐up: 24 weeks

Not estimable

(1 RCT)

⊕⊝⊝⊝
Very lowa,b

The evidence is very uncertain about the effect of FMT on serious adverse events in people with CD in remission. The number of events was very small and the data were reported in such a way that an effect size could not be calculated from the only included study for this outcome.

Any adverse events with use of FMT for maintenance of remission in CD
Follow‐up: 24 weeks

Not estimable

(1 RCT)

⊕⊝⊝⊝
Very lowa,b

The evidence is very uncertain about the effect of FMT on any adverse events in people with CD in remission. The number of events was very small and the data were reported in such a way that an effect size could not be calculated from the only included study for this outcome.

Maintenance of endoscopic remission in CD

(0 studies)

No data reported for this outcome.

Quality‐of‐life scoreswith use of FMT for maintenance of remission in CD

(0 studies)

No data reported for this outcome.

*The risk in the intervention group (and its 95% confidence interval) is based on the assumed risk in the comparison group and the relative effect of the intervention (and its 95% CI).

CD: Crohn disease; CI: confidence interval; FMT: fecal microbiota transplantation; RCT: randomized controlled trial; RR: risk ratio.

GRADE Working Group grades of evidence
High certainty: we are very confident that the true effect lies close to that of the estimate of the effect.
Moderate certainty: we are moderately confident in the effect estimate: the true effect is likely to be close to the estimate of the effect, but there is a possibility that it is substantially different.
Low certainty: our confidence in the effect estimate is limited: the true effect may be substantially different from the estimate of the effect.
Very low certainty: we have very little confidence in the effect estimate: the true effect is likely to be substantially different from the estimate of the effect.

a Downgraded one level for risk of bias. The only included study was at high risk of bias due to lack of blinding of outcome assessors and high attrition.
b Downgraded two levels due to imprecision. The number of events was very small and the data were reported in such a way that an effect size could not be calculated from the only included study for this outcome.

Background

Description of the condition

Ulcerative colitis (UC) and Crohn disease (CD), two subtypes of inflammatory bowel disease (IBD), are chronic, relapsing conditions of the gastrointestinal (GI) tract. One of the proposed mechanisms for the development of IBD involves the interplay between the gut microbiome and the immune system, which may lead to an abnormal inflammatory response in genetically susceptible individuals (Abraham 2009; Cleynen 2016). UC is characterized by inflammation of the colonic mucosa and can affect variable lengths of the colon. CD is characterized by transmural inflammation and can affect any part of the GI tract from mouth to anus, with a particular predilection for the terminal ileum (Abraham 2009; Ananthakrishnan 2015). While there is regional variation in the prevalence of IBD, with the highest rates in North America, recently its prevalence has been trending upwards globally (Ahuja 2010; Dahlhamer 2016; GBD 2020; Molodecky 2012; Weintraub 2014). The Global Burden of Disease study estimated that the prevalence of IBD increased from 3.7 million to 6.8 million between 1990 and 2017 (GBD 2020). IBD is associated with poor quality of life, significant economic burden, and increased morbidity, including the need for hospitalizations and surgical procedures (Abraham 2009; Abraham 2012; Mehta 2016). Current treatment strategies for IBD focus on the control of inflammation with medications, including corticosteroids; 5‐aminosalicylic acid (5‐ASA) preparations; immune‐modulating drugs such as azathioprine, 6‐mercaptopurine, and methotrexate; and immune‐modulating monoclonal antibodies such as infliximab, adalimumab, vedolizumab, and ustekinumab (Abraham 2009; Vindigni 2016). Unfortunately, these medical therapies have the potential to cause significant adverse effects. Moreover, while these therapies provide some benefit in many cases (Abraham 2009; Vindigni 2016), there remains a significant number of people who either do not respond to any of these treatment modalities or become refractory to them over time. Ultimately, some people may require surgical bowel resection (Vindigni 2016). The severity of IBD and poor outcomes justify the need for alternative treatment strategies that target known pathogenic factors to supplement or replace existing interventions.

Description of the intervention

There is growing evidence to suggest that 'dysbiosis' is one of the key elements in the pathogenesis of IBD and could be a potential therapeutic target (Assa 2016; Bejaoui 2015; Kostic 2014; Vindigni 2016). Dysbiosis is defined as any alteration in the composition of commensal microbial communities relative to those found in healthy individuals (Petersen 2014). In IBD, a decrease in alpha diversity, an increase in pathobionts (species of resident bacteria that activate the immune system), altered production of microbial metabolites, and an altered functional core of gut microbiota relative to that of healthy individuals have been reported (Chow 2011; De Preter 2012; Kostic 2014; Vindigni 2016).

Fecal microbiota transplantation (FMT) from healthy donors is one of the interventions used to correct dysbiosis (Cammarota 2017). While FMT is increasingly studied, most of the published literature relates to the treatment of recurrent Clostridioides difficile (formerly known as Clostridium difficile) infection (rCDI), for which its efficacy is greater than 90% (Austin 2014; Cammarota 2015; Kassam 2013; Kelly 2016; Lee 2016; Leffler 2015; van Nood 2013; Youngster 2014). The US Food and Drug Administration (FDA) considers FMT as a 'biologic product' and a 'drug' under its regulations and has labeled it as an investigational new drug, with exceptions for the treatment of rCDI where the FDA exercises enforcement discretion (FDA 2022; Moore 2014). Although FMT methods are evolving, a typical FMT procedure involves selection and screening of the donor, collection and preparation of the donor stool for infusion, preparation of the patient to receive the stool infusion, and administration of the stool via the upper or lower GI tract (Cammarota 2017). There is no single tool that has been universally agreed upon for donor screening; however, most studies have adopted a screening strategy similar to that used for a human tissue donor (Austin 2014; Cammarota 2017; Moore 2014; Owens 2013). The donor is screened via interview, and then blood and stool studies are conducted to rule out chronic diseases and active infections. After the donor is screened, the stool is collected either to be used immediately for infusion or frozen for later use. At least 30 g to 50 g of feces are typically collected and mixed with normal saline or sterile water in preparation for infusion, and the patient is usually prepared with a colonic lavage. The donor feces can be administered via an upper GI route, such as nasoduodenal tube and orally ingested capsules, or a lower GI route, such as colonoscopy and enema. Since the publication of the last version of this review, guidelines have been updated for both children and adults regarding the use of FMT for treatment of rCDI (Davidovics 2019; Kelly 2021; McDonald 2018). All modalities have been studied with overall comparable efficacy, although the colonic route is considered the most efficacious (Cammarota 2017; Lee 2016; van Nood 2013; Youngster 2014). Per published international standards, infection control precautions should be adopted during FMT preparation and administration (Cammarota 2017).

How the intervention might work

The exact mechanism by which FMT might work for inducing remission in IBD is not well‐established. However, the prevailing hypothesis is that FMT might correct the dysbiosis associated with IBD, leading to a reversal or improvement of the associated inflammation (Moayyedi 2015; Paramsothy 2017; Rossen 2015; Shi 2016; Sun 2016; Vindigni 2016). Knowledge around the use of FMT for treatment of IBD has been evolving. FMT impacts not only the composition of gut bacteria, but also the complex interconnected communities of viruses, fungi, protists, and archaea within the GI tract and their various by‐products (Lam 2022).

Currently, there is no consensus on the volume, timing, route, and frequency of fecal administration necessary to achieve remission (Cammarota 2017; Kelly 2015; Moore 2014). While a single infusion of feces is often enough to treat rCDI in most cases (Austin 2014; Cammarota 2015; Kassam 2013), multiple infusions might be required for the induction of remission in IBD, as suggested by the FOCUS trial in Australia (Paramsothy 2017). Similarly, the response to FMT in people with rCDI may not vary much with the choice of donor (Osman 2016). However, donor selection might have a significant impact on the induction of remission in UC as reported by Moayyedi 2015, in which seven of nine people who achieved clinical remission had received stool from a single donor.

The short‐ and long‐term safety of FMT in people with IBD is not well‐established (Cammarota 2017; Kelly 2015; Moore 2014). Some studies report relatively minor adverse effects such as diarrhea, abdominal bloating, abdominal cramping, and fever in the immediate postprocedure period (Khoruts 2016; Kunde 2013). In addition, FMT may increase the risk of a flare in people with IBD (Kelly 2014; Khoruts 2016). Concerns remain that the transplanted feces may contain pathogenic microorganisms and that the change in the functional core of bacteria may confer an undesirable and unanticipated outcome (Alang 2015; Cammarota 2017). Animal models of FMT have demonstrated undesired weight changes that accompanied changes in the microbiome (Blanton 2016; Ridaura 2013). Serious adverse events have been reported in individual cases, including mortality (Kelly 2014), septic shock and toxic megacolon (Solari 2014), and aspiration pneumonia (Link 2016). The FDA issued a safety alert in 2020 about the use of FMT and risk of serious adverse events, including the transmission of enteric pathogens and risk of mortality (FDA 2020a). Additionally, the FDA provided guidance about the use of FMT and risk of infection with severe acute respiratory syndrome coronavirus 2 (SARS‐CoV‐2) (FDA 2020b).

Why it is important to do this review

As the literature increasingly alludes to dysbiosis in the pathogenesis of IBD, there have been efforts to correct the dysbiosis and assess whether its correction can improve IBD‐associated outcomes (Chassaing 2011Fuentes 2017Morgan 2012Nagao‐Kitamoto 2016Rapozo 2017Schulberg 2016Vindigni 2016). Some interventions that might target the gut microbiota include the use of probiotics, prebiotics, synbiotics, nutrition therapy (including exclusive enteral nutrition), and FMT (Anderson 2012Colman 2014Paramsothy 2017Vindigni 2016). Most of these interventions have been the subject of Cochrane Reviews (Iheozor‐Ejiofor 2020Kaur 2020Nguyen 2019), including the previous version of this updated review (Imdad 2018). Since the last version of this review (Imdad 2018), additional studies on this topic have been published (Březina 2021Costello 2019Crothers 2021Fang 2021Haifer 2022Pai 2021Paramsothy 2017Sarbagili Shabat 2022Sokol 2020Sood 2019aZhao 2020). Therefore, we aimed to update the existing review to further assess the benefits and risks of FMT for treatment of IBD.

Objectives

To evaluate the benefits and safety profile of FMT for treatment of IBD in adults and children versus autologous FMT, placebo, standard medication, or no intervention.

Methods

Criteria for considering studies for this review

Types of studies

We included only randomized controlled trials (RCTs). We excluded case reports, case series, case‐control studies, single‐arm cohort studies, and non‐randomized studies with a comparator arm.

Types of participants

Eligible studies included participants who were diagnosed with UC or CD based on their history, physical examination, and gross endoscopic and histologic evaluations. We excluded studies in which the diagnosis of IBD was made without endoscopic or histologic evaluation, as these two measures were considered key initial diagnostic studies for IBD (Mowat 2011). There were no age restrictions for participants. Included studies must have followed participants for at least six weeks after FMT (Feakins 2013). We excluded studies that used FMT for the treatment of pouchitis. We also excluded studies in which participants had active enteric infections such as C. difficile, as these conditions may mimic IBD. Furthermore, we excluded studies in which FMT was performed for rCDI in people with IBD and not for induction or maintenance of remission of IBD.

Types of interventions

Eligible interventions evaluated FMT for the treatment of IBD. FMT for this review was defined as, "the administration of fecal material containing distal gut microbiota from a healthy individual (donor) to a patient with a disease or condition related to dysbiosis, or an alteration in their normal gut microbiota" (Kelly 2015). Control arms used autologous FMT, placebo, standard medication, or no intervention. We included studies irrespective of the type of stool (liquid or frozen), volume, route, frequency, and timing of the transplant (e.g. at initial diagnosis, to treat a flare, or to maintain remission). We excluded studies that used selective microbes rather than whole stool from the donor, as this intervention does not fulfill the definition of FMT (Kelly 2015).

Types of outcome measures

We measured both clinical and laboratory‐based outcomes.

Primary outcomes

  • Induction of clinical remission in UC or CD at longest follow‐up

  • Maintenance of clinical remission in UC or CD at longest follow‐up

  • Serious adverse events in UC or CD as defined by study authors

We measured the primary outcomes using the number of participants achieving clinical remission, maintaining remission, or experiencing serious adverse events, expressed as a proportion of the number of participants randomized to each group in a given trial. Further details on how data were extracted for primary outcomes are provided in the Measures of treatment effect section.

We analyzed the data separately for primary outcomes in the induction and maintenance phases of treatment of UC and CD. The primary outcome of induction of clinical remission was measured at week eight and week 12 of follow‐up, and at the longest follow‐up. For the remaining primary outcomes, the longest follow‐up time was considered before the trial was open for analysis.

Secondary outcomes

  • Any adverse events in UC or CD as defined by study authors

  • Endoscopic remission in UC or CD at longest follow‐up

  • Quality of life (i.e. Inflammatory Bowel Disease Questionnaire [IBDQ] scores) at the time of measurement of the primary outcomes

  • Clinical response in UC or CD at longest follow‐up

  • Endoscopic response in UC or CD at longest follow‐up

  • Withdrawals in studies on UC or CD

  • Laboratory measures of inflammation, including erythrocyte sedimentation rate (ESR), C‐reactive protein (CRP), and fecal calprotectin (FC), all of which were recorded as continuous outcomes, in UC or CD at longest follow‐up

  • Microbiome outcomes

We analyzed the data separately for secondary outcomes in the induction and maintenance phases of remission in UC and CD.

Search methods for identification of studies

Electronic searches

For this update, we searched the following databases:

  • Cochrane Central Register of Controlled Trials (CENTRAL; Issue 11, 2022) in the Cochrane Library;

  • MEDLINE Ovid (1946 to 22 December 2022);

  • Embase Elsevier (1974 to 22 December 2022);

  • International Standard Registered Clinical/Social Study Number registry (ISRCTN; 22 December 2022).

We applied no limits on our searches. The search strategies are available in Appendix 1.

Searching other resources

For both the 2018 version (Imdad 2018) and current version of this review, we searched ClinicalTrials.gov (www.clinicaltrials.gov) and the ISRCTN metaRegister of Controlled Trials (mRCT; www.isrctn.com/page/mrct) for ongoing trials. We also searched the reference sections of previously published RCTs and meta‐analyses on this topic.

In the previous version of this review (Imdad 2018), we searched the Conference Proceedings Citation Index database for conference abstracts. However, for the present review, Embase covers proceedings of the above conferences from the year 2010 onward.

Data collection and analysis

Selection of studies

For this update, at least two review authors (AI, NP, MZ, and NZM) conducted the initial screening to select potentially eligible studies by reviewing titles and abstracts. After the initial title and abstract screening, two review authors from the study team (AI, NP, MZ, and NZM) reviewed the full texts of selected studies and then made final decisions regarding inclusion or exclusion. At each stage of the screening process, we resolved any discrepancies by discussion and consensus.

Data extraction and management

At least two review authors (AI, NP, MZ, and NZM) independently extracted and updated data in the pretested Microsoft Excel sheet (available on request) that had been maintained since the first version of this review. We extracted information on the characteristics of included studies such as authors, date of publication, journal, study site, study design, age of participants, study population (inclusion/exclusion criteria), details of intervention (type, volume, route, and frequency of administration), outcomes (primary and secondary), and risk of bias. Then, we extracted the raw values of event occurrences (numerators) in the case and control groups, along with the total number of participants randomized (denominators) to each group. We extracted data on an intention‐to‐treat (ITT) basis, which considers the initial allocation of participants to the case or control groups, irrespective of whether they received the intervention or completed follow‐up (Gupta 2011). When data for continuous outcomes were reported as medians with interquartile ranges (IQR), we converted the values to means with standard deviations (SD) using methods given in Hozo 2005, which assume a normal distribution of data

Assessment of risk of bias in included studies

We used the Cochrane RoB 1 tool to assess the risk of bias in the included RCTs (Higgins 2011). Briefly, these assessments were based on six criteria: sequence generation, allocation concealment, blinding, incomplete outcome data, publication bias, and other bias. Each category was judged at 'low,' 'high,' or 'unclear' risk of bias.

Measures of treatment effect

We expected that the authors of included studies would report a range of clinical, endoscopic, and histologic outcomes in response to treatment with FMT. The most important of these outcomes was 'induction of clinical remission,' which was a primary outcome of our systematic review. We considered clinical remission as defined by the included studies (e.g. Mayo score for UC studies and Crohn's Disease Activity Index for CD studies). If the primary outcome was reported as a combination of clinical and endoscopic or histologic assessment, we extracted data for the combined or 'composite' outcome.

We considered the outcomes related to induction of remission in UC and CD at week eight, week 12, and the longest follow‐up point post‐FMT. If a primary outcome in a study was not reported at exactly eight weeks but between six and 10 weeks post‐FMT, it was included as an outcome at eight weeks. Similarly, if a primary outcome was not reported at exactly 12 weeks but between 10 and 14 weeks post‐FMT, it was included as an outcome at 12 weeks. Regardless of the number of weeks at which the primary outcome was measured, we analyzed the data reported at the time point farthest from the intervention as 'the longest follow‐up' to accommodate as many studies as possible into a single analysis. However, we considered the data at the longest follow‐up only up to the time point before the trial was open for analysis.

For maintenance of remission in UC and CD, we considered outcomes from studies in which all the participants were in remission at the time of randomization, and we considered these data at the longest follow‐up.

We calculated the risk ratio (RR) and corresponding 95% confidence interval (CI) for all dichotomous outcomes. We calculated the mean difference (MD) and corresponding 95% CI for continuous outcomes.

Unit of analysis issues

For studies that had multiple intervention groups (e.g. factorial design), the data were extracted in such a way that the only difference between the case and control groups was administration of FMT. Similarly, if a study had more than one intervention or control group, the groups were combined in a single comparison of 'donor‐based FMT versus control' (including autologous FMT). Co‐interventions were permitted if they were uniformly applied to both the intervention and control groups. We only considered the effect of the first treatment attempt as defined by the authors. The treatment may have included multiple infusions of FMT; however, if a patient received study treatment (intervention or control) more than once, we ignored the subsequent attempts. Such a scenario might occur if the authors decided to treat all participants in the control group with the study intervention at the end of a randomized trial. Adverse events were considered as reported by the study authors, and we assumed that each adverse event was an independent event unless the published report indicated otherwise.

Dealing with missing data

Attrition is an important factor that may affect the validity of studies, and differential dropout rates between study groups can lead to biased estimates of effect size (Dumville 2006). We described missing data, including withdrawals and reasons for withdrawal, as reported by the study authors. We contacted the authors if data were missing and no reasons were provided. When authors applied complete data to withdrawn participants (e.g. imputed using regression methods), we extracted the latter. If data were not available for the primary outcomes of this review, we contacted the authors for additional information. All data from the RCTs were analyzed on an ITT basis. Specifically, we conducted our analyses using the total number of participants originally randomized to each study group, rather than the number of participants who completed each study and for whom data were reported. As such, we assumed that participants with missing values for the primary outcomes did not develop the outcome of interest in either arm of the study and experienced treatment failure.

Assessment of heterogeneity

We assessed clinical, methodologic, and statistical heterogeneity across the included studies. Clinical heterogeneity was assessed by comparing the distributions of important factors such as study population, dose, and frequency of FMT. Methodologic heterogeneity was assessed by comparing data included in the risk of bias tables. Statistical heterogeneity was assessed by visual inspection of the forest plots, the I² statistic, and the P value of the Chi² test. If the forest plot was indicative of a heterogeneous effect (opposite direction or prominent difference in magnitude of effect), while the I² values were greater than 50% and P values for the Chi² test were less than 0.1, statistical heterogeneity was considered to be substantial. We explored potential explanations for heterogeneity using subgroup analyses.

Assessment of reporting biases

We aimed to assess potential publication bias based on symmetry of the funnel plots. We planned to construct funnel plots if at least 10 studies were included in the pooled analysis and investigate asymmetry in the funnel plots with Egger's test as appropriate.

Data synthesis

We synthesized data from individual trials using meta‐analysis when the interventions, participant groups, and outcomes were sufficiently similar (as determined by consensus) using Review Manager Web (RevMan Web 2023). We planned to conduct separate meta‐analyses for use of FMT in the induction and maintenance phases of remission in UC and CD. For dichotomous outcomes, we calculated pooled RRs and corresponding 95% CIs. We combined RRs (number of participants who experienced the event) and rate ratios (number of participants who experienced the event‐days/months/years) for two reasons: studies were expected to be completed in a relatively short duration, and the primary outcome (induction of clinical remission) was not expected to be a recurrent event. All meta‐analyses were conducted using the log RR, with all reported results transformed back into the RR metric for ease of interpretability. We considered a risk of difference of at least 10% to 15% to be a minimally important clinical difference (MICD) between the two groups for the primary outcome.

For continuous outcomes, data were combined to obtain pooled MDs and corresponding 95% CIs. When studies used different scales to measure the same underlying construct, we calculated the standardized mean difference (SMD; Hedges' g value) and corresponding 95% CI. We used a random‐effects model to conduct all meta‐analyses. The rationale for using a random‐effects model was that we expected possible heterogeneity in the effects of FMT due to factors such as dosage, frequency, or donor source (e.g. single donor or pooling of multiple donors), as noted in the results of published studies.

Subgroup analysis and investigation of heterogeneity

We planned the following a priori subgroup analyses:

  • Route of administration: upper GI tract (i.e. oral capsules; nasogastric, nasoduodenal, nasojejunal tube) versus lower GI tract (i.e. colonoscopy, enema);

  • Type of donor: single donor (i.e. one person's stool administered per dose) versus multiple donors (i.e. more than one person's stool blended per dose);

  • Age of participants: children versus adults;

  • Frequency of FMT administration: single infusion versus multiple infusions during treatment period.

We used the Chi2 test to determine any statistical significance between the subgroup analyses.

The subgroup analyses were considered separately for use of FMT in the induction and maintenance phases of remission in UC and CD. Subgroup analyses were conducted when at least 10 studies were available for analysis.

Sensitivity analysis

The following a priori sensitivity analysis was performed:

  • choice of statistical model: random‐effects versus fixed‐effect models for primary outcomes.

Given that we performed an ITT analysis, which included randomized participants who may not have received the intervention and completed follow‐up, we also performed post‐hoc available case analyses for the primary outcomes, in which only those participants who completed follow‐up were included. We also updated the post‐hoc analysis conducted in the last version of this review for studies that defined induction of remission with a combination of clinical and endoscopic/histologic criteria (Imdad 2018).

The sensitivity and subgroup analyses were conducted for the primary outcomes only, but separately for use of FMT in the induction and maintenance phases of remission in UC and CD.

Summary of findings and assessment of the certainty of the evidence

We assessed the overall certainty of the evidence supporting the primary outcomes and selected secondary outcomes using GRADE (Guyatt 2011). This method takes into consideration the impact of the types of studies (i.e. randomized versus observational), risk of bias, imprecision, inconsistency (i.e. unexplained heterogeneity), indirectness, and potential publication bias. The overall certainty of the evidence was rated as 'high,' 'moderate,' 'low,' or 'very low.' We presented the results of the GRADE evaluation in summary of findings tables for all primary outcomes (i.e. induction and maintenance of remission and serious adverse events) and the following secondary outcomes: any adverse events, induction of endoscopic remission, and quality of life. We reported the GRADE evaluations separately for use of FMT for induction of remission in UC, maintenance of remission in UC, induction of remission in CD, and maintenance of remission in CD at longest follow‐up, along with the follow‐up time ranges.

Results

Description of studies

Results of the search

In the previous version of this review (Imdad 2018), a search conducted on 19 March 2018 identified 1020 studies, and after removal of duplicates, 665 studies were retained for the title and abstract screening. Out of 34 studies reviewed by full‐text, eight reports of four studies were included (Costello 2019Moayyedi 2015Paramsothy 2017Rossen 2015), of which one was an abstract version of what has subsequently become a full‐length paper (Costello 2019). That search identified 13 ongoing studies. For this updated version of the review, we included the four full studies from the previous review (Figure 1).


Study flow diagram.

Study flow diagram.

A literature search was conducted on 15 January 2022 and updated on 22 December 2022, which identified 4602 studies (Figure 1). After removal of duplicates, 3144 studies were retained for the title and abstract screening, and 96 studies met the criteria for full‐text review. We excluded 44 studies for reasons outlined in the Characteristics of excluded studies table, four studies are awaiting classification (Characteristics of studies awaiting classification table), and 29 studies are ongoing (Characteristics of ongoing studies table).

In summary, four studies were carried over from the last version of this review and eight studies were newly included, of which two were previously ongoing and are now completed and published, for a total of 12 studies published in 27 reports in this systematic review (Březina 2021Costello 2019Crothers 2021Fang 2021Haifer 2022Moayyedi 2015Pai 2021Paramsothy 2017Rossen 2015Sarbagili Shabat 2022Sokol 2020Sood 2019a).

Included studies

Twelve RCTs assessed FMT for the treatment of IBD in peer‐reviewed journals (Březina 2021Costello 2019Crothers 2021Fang 2021Haifer 2022Moayyedi 2015Pai 2021Paramsothy 2017Rossen 2015Sarbagili Shabat 2022Sokol 2020Sood 2019a).

Eleven studies assessed FMT for the treatment of UC, of which eight studies assessed FMT for induction of clinical remission in adults with UC (Březina 2021Costello 2019Crothers 2021Fang 2021Moayyedi 2015Paramsothy 2017Rossen 2015Sarbagili Shabat 2022). One study assessed FMT for induction of clinical remission in children with UC (Pai 2021). One study assessed FMT for both induction and maintenance of remission in UC (Haifer 2022), while one study assessed FMT for only maintenance of remission in UC (Sood 2019a). None of the included studies assessed the use of FMT for induction of remission in CD. One study assessed FMT for maintenance of remission in CD (Sokol 2020). The complete details of these studies can be found in the Characteristics of included studies table.

Country

Three studies were conducted in Australia (Costello 2019Haifer 2022Paramsothy 2017), two in Canada (Moayyedi 2015Pai 2021), one in China (Fang 2021), one in the Czech Republic (Březina 2021), one in France (Sokol 2020), one in India (Sood 2019a), one in Israel and Italy (Sarbagili Shabat 2022), one in the Netherlands (Rossen 2015), and one in the US (Crothers 2021). Five studies were conducted at a single center (Březina 2021Crothers 2021Fang 2021Rossen 2015Sood 2019a), and seven were conducted at multiple centers (Costello 2019Haifer 2022Moayyedi 2015Pai 2021Paramsothy 2017Sarbagili Shabat 2022Sokol 2020).

Study population
Age and gender

The percentages of males in the included studies ranged from 20% (Fang 2021) to 72.5% (Sarbagili Shabat 2022). The ages of participants ranged from children (Pai 2021) to adults with a mean age of 48 years (Fang 2021).

History of prior medication treatment

All studies included participants who had previously received some form of treatment for IBD (i.e. no studies included only treatment‐naive participants), and only one study excluded people who had previously received biologic therapy as part of their treatment (Fang 2021).

Duration of disease

The mean duration of disease in the studies on adults with UC ranged from 4.29 years (Sood 2019a) to 9.35 years (Crothers 2021). The mean duration of disease in the study on participants with CD was nine years (Sokol 2020).

Severity of disease

All 10 studies on FMT for induction of remission in UC reported the severity of disease during enrollment, of which nine studies included people experiencing mild‐to‐moderate UC with correlating Mayo scores at the time of inclusion (Březina 2021Costello 2019Crothers 2021Haifer 2022Moayyedi 2015Pai 2021Paramsothy 2017Rossen 2015Sarbagili Shabat 2022), and one study included people with mild, moderate, and severe UC (Fang 2021). The two studies that assessed FMT for maintenance of remission in UC included people who were induced into remission with FMT (Haifer 2022Sood 2019a), while one study that assessed FMT for maintenance of remission in CD included people who were induced into remission with steroids (Sokol 2020).

Indications for fecal microbiota transplantation

Ten studies used FMT for induction of remission in participants with active UC (Březina 2021Costello 2019Crothers 2021Fang 2021Haifer 2022Moayyedi 2015Pai 2021Paramsothy 2017Rossen 2015Sarbagili Shabat 2022). Two studies used FMT for maintenance of remission in UC (Haifer 2022Sood 2019a), and one study used FMT for maintenance of remission in CD (Sokol 2020).

Intervention
Donors

All 12 studies used feces from apparently healthy donors. In nine studies, the donors were not related to the study participants receiving FMT (Březina 2021Costello 2019Crothers 2021Haifer 2022Moayyedi 2015Pai 2021Paramsothy 2017Sokol 2020Sood 2019a). In one study, all donors were related to the recipient (Fang 2021), and in another study, there was a mixture of related and unrelated donors (Rossen 2015). One study did not specify whether the donors were related to the recipients (Sarbagili Shabat 2022).

Route

Two studies administered FMT to the upper GI tract only, of which one used oral capsules (Haifer 2022) and one used nasoduodenal tubes (Rossen 2015). Nine studies administered FMT to the lower GI tract only, of which three used enemas (Březina 2021Moayyedi 2015Pai 2021), four used colonoscopies (Fang 2021Paramsothy 2017Sokol 2020Sood 2019a), and two used a combination of enemas and colonoscopy (Costello 2019Sarbagili Shabat 2022). One study used a combination of oral capsules and colonoscopy (Crothers 2021).

Number of administrations

The number of FMT administrations varied across studies. Two studies gave only a single administration (Fang 2021Sokol 2020), whereas the other studies gave multiple administrations, with a maximum of 85 FMT doses in Crothers 2021.

Weight of stool

The weight of stool used in each FMT administration ranged from 0.35 g per capsule (Haifer 2022) to 120 g via nasoduodenal tube (Rossen 2015).

Volume of stool

The volume of FMT delivered in each administration ranged from 50 mL (Moayyedi 2015) to 500 mL (Rossen 2015). One study that used oral capsules administered six capsules four times daily for one week, then six capsules twice daily for one week, followed by six capsules daily for another six weeks to induce remission and two capsules daily for another 48 weeks to maintain remission in UC (Haifer 2022).

Colon preparation

Nine studies used colon preparation before FMT (Březina 2021Costello 2019Crothers 2021Fang 2021Haifer 2022Rossen 2015Sarbagili Shabat 2022Sokol 2020Sood 2019a), while the others did not.

Comparison

Two studies used autologous FMT as the comparator (Costello 2019Rossen 2015), seven used sham placebo that may have contained saline or water (Crothers 2021Haifer 2022Moayyedi 2015Pai 2021Paramsothy 2017Sokol 2020Sood 2019a), one used mesalamine via enema (Březina 2021), one used the UC Exclusion Diet (Sarbagili Shabat 2022), and one used 'routine therapy' that varied depending on the severity of disease but potentially included mesalamine, corticosteroids, or both (Fang 2021). The volume, frequency of administration, and colon preparation were similar between the FMT and control groups in the respective studies except for Fang 2021 and Sarbagili Shabat 2022Fang 2021 used 'routine therapy' as the comparator as opposed to placebo, so these control participants did not have colon preparation, whereas the treatment group that received FMT via colonoscopy did have colon preparation. Similarly, Sarbagili Shabat 2022 placed the control participants on the UC Exclusion Diet, so they did not receive colon preparation either.

Outcomes

All 12 studies reported data for at least one of the primary outcomes in this review. For the outcome of induction of clinical remission, two studies defined the outcome of clinical scores only (Pai 2021Sarbagili Shabat 2022), while eight studies reported the composite of clinical and endoscopic remission (Březina 2021Costello 2019Crothers 2021Fang 2021Haifer 2022Moayyedi 2015Paramsothy 2017Rossen 2015). Three studies reported on maintenance of remission in IBD, of which one study reported on maintenance of steroid‐free remission in CD at week 24 (Sokol 2020), while two studies reported on maintenance of steroid‐free clinical remission in UC at week 48 (Sood 2019a) and at week 56 (Haifer 2022). The outcome of 'induction of clinical remission' was defined by the study authors as:

  • Březina 2021: Total Mayo score 2 or less with no subscore greater than 1 at week 12;

  • Costello 2019: Total Mayo score 2 or less with endoscopic Mayo score 1 or less at week eight; clinical remission as a non‐composite outcome was defined by Simple Clinical Colitis Activity Index (SCCAI) score;

  • Crothers 2021: Modified Mayo score 2 or less including Rectal Bleeding (RB) subscore of 0, Stool Frequency (SF) subscore of 0 or with at least 1‐point decrease from baseline to achieve SF subscore 1 or less, and endoscopic subscore 1 or less at week 12;

  • Fang 2021: Mayo score 2 or less with each subscore 1 or less at week eight;

  • Haifer 2022: Total Mayo score 2 or less, with all Mayo subscores 1 or less, and at least 1‐point reduction of Mayo endoscopic subscore from baseline endoscopy at week eight;

  • Moayyedi 2015: Full Mayo score less than 3 and endoscopic Mayo score of 0 at week seven;

  • Pai 2021: Pediatric Ulcerative Colitis Activity Index (PUCAI) less than 15 at week six (actual longest follow‐up was week 30, but it appeared that trial first opened for analysis at week six);

  • Paramsothy 2017: Total Mayo score 2 or less, with all subscores 1 or less, and at least 1‐point reduction from baseline in endoscopy subscore at week eight;

  • Rossen 2015: composite of clinical remission (SCCAI score 2 or less) in combination with at least 1‐point improvement on combined Mayo endoscopic score of sigmoid and rectum versus baseline sigmoidoscopy at week 12;

  • Sarbagili Shabat 2022: clinical steroid‐free remission (SCCAI less than 3) at week eight.

Follow‐up

The follow‐up time for measurement of induction of remission in UC ranged from six weeks (Pai 2021Rossen 2015) to 12 weeks (Březina 2021Crothers 2021Rossen 2015). Five studies measured induction of clinical remission in UC at eight weeks (Costello 2019Fang 2021Haifer 2022Paramsothy 2017Sarbagili Shabat 2022). Among the two studies that assessed maintenance of remission in UC, one reported outcomes after 48 weeks (Sood 2019a) and the other reported after 56 weeks (Haifer 2022). The study that assessed use of FMT for maintenance of remission in CD reported data after 26 weeks (Sokol 2020).

Excluded studies

We excluded 44 studies for reasons given in the Characteristics of excluded studies table. In summary, 21 studies had ineligible comparators (i.e. the comparison groups received FMT or did not have IBD), nine studies had ineligible study designs, six studies had ineligible study populations (i.e. five studies used FMT for treatment of rCDI rather than IBD and one study used FMT for treatment of pouchitis), five studies had ineligible interventions, two studies had incompatible lengths of follow‐up, and one study was not available for review.

Studies awaiting classification

Four studies are awaiting classification for one of the following reasons: the study was terminated; despite our best efforts to gather data or clarify the study's status with the authors, it was unclear whether it was terminated, ongoing, or temporarily on hold; an English version of the study was not available; or the study had been completed but the author(s) had not published or granted access to their data (Caenepeel 2022Jitsumura 2022NCT02272868Zhang 2019). We attempted to contact the listed authors of all studies awaiting classification to inquire about their status and whether any potential publications were pending.

Ongoing studies

Twenty‐nine studies are ongoing (CTRI/2021/03/032131EUCTR 2019‐003816‐29NCT01961492NCT02335281NCT02998112NCT03078803NCT03110289NCT03273465NCT03483246NCT03561532NCT03582969NCT03716388NCT03804931NCT03998488NCT04034758NCT04202211NCT04328922NCT04373473NCT04434872NCT04521205NCT04637438NCT04924270NCT04970446NCT04997733NCT05030064NCT05538026Pai 2019Stallmach 2022UMIN000033127). We attempted to contact the listed authors of all ongoing studies to inquire about their status and whether any potential publications were pending.

Risk of bias in included studies

A summary of the risk‐of‐bias assessments is reported in Figure 2.


Risk of bias summary: review authors' judgements about each risk of bias item for each included study.

Risk of bias summary: review authors' judgements about each risk of bias item for each included study.

Allocation

All 12 studies adequately described the methods for random sequence generation and were at low risk of bias (Březina 2021Costello 2019Crothers 2021Fang 2021Haifer 2022Moayyedi 2015Pai 2021Paramsothy 2017Rossen 2015Sarbagili Shabat 2022Sokol 2020Sood 2019a). Fang 2021 did not explicitly address random sequence generation in the study text but specified the method in the published protocol and therefore was considered at low risk.

Nine studies were at low risk of bias in the domain of allocation concealment (Costello 2019Crothers 2021Haifer 2022Moayyedi 2015Pai 2021Paramsothy 2017Rossen 2015Sarbagili Shabat 2022Sokol 2020), and three studies were at unclear risk (Březina 2021Fang 2021Sood 2019a).

Blinding

Ten studies were at low risk of bias in the domain of blinding of participants (Costello 2019Crothers 2021Haifer 2022Moayyedi 2015Pai 2021Paramsothy 2017Rossen 2015Sokol 2020Sood 2019a), and two studies were at high risk (Březina 2021Fang 2021). Ten studies were at low risk of bias in blinding of outcome assessors and study investigators (Březina 2021Costello 2019Crothers 2021Fang 2021Haifer 2022Moayyedi 2015Paramsothy 2017Rossen 2015Sarbagili Shabat 2022Sood 2019a), and two studies were at high risk (Pai 2021Sokol 2020). Březina 2021 was at low risk of bias in blinding of outcome assessors as the endoscopy pictures were read at a central location. However, this study may be at high risk of bias for other outcomes such as adverse events.

Incomplete outcome data

Nine studies were at low risk of bias related to attrition (Březina 2021; Costello 2019; Fang 2021; Haifer 2022; Moayyedi 2015; Paramsothy 2017; Rossen 2015; Sarbagili Shabat 2022; Sood 2019a). Three studies were at high risk of bias based on incomplete data, as they had high attrition rates (Crothers 2021; Pai 2021; Sokol 2020).

Selective reporting

All included studies were at low risk of bias in selective reporting.

Other potential sources of bias

We did not identify any other major risks of bias in the included studies.

Effects of interventions

See: Summary of findings 1 Fecal microbiota transplantation compared to control for induction of remission in ulcerative colitis; Summary of findings 2 Fecal microbiota transplantation compared to control for maintenance of remission in ulcerative colitis; Summary of findings 3 Fecal microbiota transplantation compared to control for induction of remission in Crohn disease; Summary of findings 4 Fecal microbiota transplantation compared to control for maintenance of remission in Crohn disease

In this section, we describe the results of our review of studies on FMT for treatment of IBD, separately for: induction of remission in UC, maintenance of remission in UC, induction of remission in CD, and maintenance of remission in CD.

Comparison 1: fecal microbiota transplantation for induction of remission in ulcerative colitis

Primary outcomes
Induction of clinical remission in ulcerative colitis at longest follow‐up

Ten studies reported data on the use of FMT for induction of clinical remission in 468 participants with UC. Two studies used mesalamine as the control, two used autologous FMT, five used sham therapy such as water and isotonic saline, and one used the UC Exclusion Diet. The combined results at longest follow‐up showed that FMT may increase rates of induction of clinical remission in participants with UC (RR 1.79, 95% CI 1.13 to 2.84; low‐certainty evidence; Analysis 1.1Figure 3). We downgraded the certainty of evidence due to risk of bias and imprecision (summary of findings Table 1).


Forest plot of comparison: 1 Fecal microbiota transplantation (FMT) versus control for treatment of inflammatory bowel disease, outcome: 1.1 Induction of clinical remission in ulcerative colitis at longest follow‐up.

Forest plot of comparison: 1 Fecal microbiota transplantation (FMT) versus control for treatment of inflammatory bowel disease, outcome: 1.1 Induction of clinical remission in ulcerative colitis at longest follow‐up.

Publication bias

The funnel plot was symmetrical (Figure 4).


Funnel plot: FMT for induction of clinical remission for UC. The graph appears symmetrical.

Funnel plot: FMT for induction of clinical remission for UC. The graph appears symmetrical.

Subgroup analyses

We performed subgroup analyses based on the route of FMT administration (Analysis 1.4), type of donor (Analysis 1.5), age of participants (Analysis 1.6), and frequency of FMT (Analysis 1.7). The number of included studies in each subgroup analysis was small and the CIs of the summary estimates overlapped, indicating similar effects across all subgroups.

Sensitivity analyses

A fixed‐effect model for induction of clinical remission in UC showed similar results compared to the primary random‐effects model used in this review (RR 1.88, 95% CI 1.37 to 2.57; 10 studies, 468 participants; Analysis 1.8; compare with Analysis 1.1).

Our primary analysis was based on ITT, in which we considered all participants randomized to the case and control groups irrespective of whether they received the intervention or completed follow‐up. A post‐hoc sensitivity analysis that considered only participants who received the intervention and completed follow‐up yielded similar results (RR 1.77, 95% CI 1.07 to 2.94; 382 participants; Analysis 1.9).

We decided a priori that the primary outcome of 'clinical remission' would be based on a clinical score (e.g. Mayo score or SCCAI). However, there was also interest in examining composite clinical outcomes in which both clinical and endoscopic/histologic criteria were considered. A random‐effects meta‐analysis of studies that reported a composite outcome for induction of remission showed that FMT may increase rates of induction of remission by about two times compared to control (RR 2.13, 95% CI 1.51 to 3.02; 8 studies, 392 participants; Analysis 1.10).

Induction of clinical remission in ulcerative colitis at weeks eight and 12

FMT may increase induction of remission after eight weeks in participants with active UC (RR 1.68, 95% CI 0.93 to 3.05; 8 studies, 408 participants; Analysis 1.2). FMT may also increase induction of remission after 12 weeks; however, the CIs around the summary estimate were wide and included a possibility of no effect (RR 1.54, 95% CI 0.89 to 2.66; 3 studies, 108 participants; Analysis 1.3).

Serious adverse events

Ten studies reported data on serious adverse events when FMT was used for induction of remission in participants with active UC. The evidence was very uncertain about the risk of serious adverse events with use of FMT in active UC (RR 1.77, 95% CI 0.88 to 3.55; 468 participants; very low‐certainty evidence; Analysis 1.11Figure 5). We downgraded the certainty of evidence due to risk of bias and very serious imprecision of the summary estimate (summary of findings Table 1). Serious adverse events included worsening of UC necessitating intravenous steroids or surgery, infection, small bowel perforation, and pneumonia.


Forest plot of comparison: 1 Fecal microbiota transplantation versus control for participants with ulcerative colitis, outcome: 1.8 Serious adverse events.

Forest plot of comparison: 1 Fecal microbiota transplantation versus control for participants with ulcerative colitis, outcome: 1.8 Serious adverse events.

Publication bias

The funnel plot was symmetrical (Figure 6).


Funnel plot: serious adverse events for use of FMT for induction of remission in UC. The graph appears symmetrical.

Funnel plot: serious adverse events for use of FMT for induction of remission in UC. The graph appears symmetrical.

Subgroup analyses

We performed subgroup analyses for the risk of serious adverse events after FMT based on route of administration (Analysis 1.12), type of donor (Analysis 1.13), and age of participants (Analysis 1.14). The number of included studies in each subgroup analysis was small and the CIs overlapped the line of no effect, indicating similarity of subgroup summary estimates.

Sensitivity analyses

A sensitivity analysis based on the use of a fixed‐effect model showed similar results (RR 1.87, 95% CI 0.95 to 3.68) to those reported using a random‐effects model (Analysis 1.15). A post‐hoc sensitivity analysis based on available cases showed similar results (RR 1.74, 95% CI 0.88 to 3.47; 382 participants, Analysis 1.16).

Secondary outcomes
Any adverse events

There was little to no difference in any adverse events between the FMT and control groups of participants with active UC (RR 0.99, 95% CI 0.85 to 1.16; 9 studies, 417 participants; low‐certainty of evidence; Analysis 1.17). We downgraded the certainty of evidence due to risk of bias and imprecision of the summary estimate (summary of findings Table 1). Common adverse events included abdominal pain, nausea, flatulence, bloating, headaches, and dizziness.

Induction of endoscopic remission in ulcerative colitis at longest follow‐up

FMT may increase rates of induction of endoscopic remission in UC at longest follow‐up; however, the CIs around the summary estimate were wide and included a possibility of no effect (RR 1.45, 95% CI 0.64 to 3.29; 5 studies, 285 participants; low‐certainty evidence; Analysis 1.18). We downgraded the certainty of evidence due to very serious imprecision of the summary estimate (summary of findings Table 1).

Quality of life at longest follow‐up

Five studies reported quality of life (IBDQ) scores in UC at the longest follow‐up for FMT versus control groups. However, two of these studies were excluded from the quantitative analysis because one provided means without SD values (Moayyedi 2015) and one provided data in the form of box plots (Rossen 2015). Thus, the meta‐analysis of final IBDQ scores was based on three studies with 131 participants. The evidence was very uncertain about whether FMT in participants with active UC increased quality of life at longest follow‐up. The CIs were wide and included the possibility of no effect (MD 15.34, 95% CI −3.84 to 34.52; very low‐certainty evidence; Analysis 1.19). We downgraded the certainty of evidence due to inconsistency and very serious imprecision of the summary estimate (summary of findings Table 1). One study reported data as medians and IQR (Haifer 2022), which we converted to means and SDs using a calculator based on methods by Hozo 2005. A sensitivity analysis without this study showed similar results but with a more imprecise CI around the summary estimate (MD 22.20, 95% CI 0.63 to 43.78; Analysis 1.20).

Induction of clinical response in ulcerative colitis at longest follow‐up

FMT may increase rates of clinical response in participants with UC at the longest follow‐up (RR 1.33, 95% CI 0.96 to 1.84; 10 studies, 468 participants; Analysis 1.21).

Induction of endoscopic response in ulcerative colitis at longest follow‐up

FMT may increase rates of endoscopic response in participants with active UC; however, the CIs around the summary estimate were imprecise and a null effect could not be ruled out (RR 1.48, 95% CI 0.79 to 2.76; 3 studies, 164 participants; Analysis 1.22).

Withdrawals in studies on induction of remission in ulcerative colitis

There was little to no difference in withdrawal rates between the FMT and control groups of participants with active UC (RR 0.91, 95% CI 0.62 to 1.34; 10 studies, 468 participants; Analysis 1.23).

Erythrocyte sedimentation rate at longest follow‐up

There was no evidence of a difference in ESR at longest follow‐up between FMT and control groups of participants with active UC (MD 2.98 mm/hour, 95% CI −0.38 to 6.34; 2 studies, 113 participants; Analysis 1.24).

C‐reactive protein at longest follow‐up

There was no evidence of a difference in CRP at longest follow‐up between FMT and control groups of participants with active UC (MD 1.11 mg/L, 95% CI −1.85 to 4.08; 3 studies, 128 participants; Analysis 1.26). Another study, Pai 2021, also measured CRP, but the data were not reported as final means and SDs and could not be combined with data from the other three studies.

Fecal calprotectin at longest follow‐up

Three studies of 131 participants with UC reported data on FC at longest follow‐up for the FMT versus control groups (Crothers 2021Haifer 2022Paramsothy 2017). FMT may decrease FC levels; however, the CIs were wide and included the possibility of no effect (MD −69.49 μg/mg, 95% CI −260.62 to 121.65; 3 studies, 131 participants; Analysis 1.28). Two other studies also measured FC (Costello 2019Pai 2021), but their data were not reported as final means and SDs and could not be combined with data from the other three studies. One study reported data as medians and IQR  (Haifer 2022), which we converted to means and SDs using a calculator based on methods by Hozo 2005.

Microbiome outcomes

Table 1 provides the summary of methods used to assess microbiome‐related outcomes and the summary of key findings.

Open in table viewer
Table 1. Microbiome outcomes

Study

Primary disease addressed

Sequencing platform

Alpha diversity

Beta diversity

Notable bacterial taxonomic profiles

Methods and main findings of microbiome analysis

Moayyedi 2015

UC

MiSeq Illumina

Not reported

"Beta diversity (Bray‐Curtis dissimilarity) was calculated using the Phyloseq R package. There was a statistically significant change in microbiota composition with more diversity in the treatment group compared with the placebo group at week 6 vs baseline (P= 0.02, Mann‐Whitney U test)"

"Relative abundance and taxonomic profiles were computed using Quantitative Insights Into Microbial Ecology. Taxonomic profiles of the donors highlighted distinct microbial differences between the 2 most common donors (A and B) used in this study."

 

  • Lachnospiraceae

  • Blautia

  • Faecalibacterium

  • Ruminococcaceae

  • Clostridiaceae

  • Subdoligranulum

  • Bacteroides

  • Prevotella

  • Lachnospira

  • Clostridiales

  • Erysipelotrichaceae

  • Ruminococcaceae

  • Oscillospira

  • Ruminococcus

  • Eubacterium

"The study authors sequenced the V3 region of the 16S rRNA gene using MiSeq Illumina technology. QIIME and the Phyloseq R package was used for curation of data and in‐depth microbiota analyses. This study compared the microbiota of several different donors. Moreover, the authors compared the microbiota of FMT recipients during the time course of the study following FMT. Finally, responders and non‐responders microbiota were compared. Microbiota structure analyses utilizing the Bray‐Curtis dissimilarity metric demonstrated that patients receiving FMT showed a change in their microbiota following FMT. This shift led to microbiota that was more similar to the donor microbiota over time. Moreover, the authors observed a difference in the microbiota between responders and non‐responders. Interestingly, two donors were associated with more successful FMTs and these individuals harbored increased Ruminococcus and Lachnospiraceae and decreased abundance of Streptococci and Escherichia."

Paramsothy 2017

UC

MiSeq Illumina

"Increased α diversity was specific to faecal microbiota transplantation; three patients allocated placebo who met criteria for the primary outcome showed no change in diversity. Faecal microbiota transplantation therapy was associated with a significant increase in α diversity, which was durable 8 weeks after therapy completion. patients achieving the primary outcome seemed to have higher baseline microbial diversity before faecal microbiota transplantation and a greater increase in α diversity with faecal microbiota transplantation."

Not reported

"Several microbial taxa were associated with remission after double‐blind faecal microbiota transplantation (Barnesiella spp, Parabacteroides spp, Clostridium cluster IV, and Ruminococcus spp) and after open‐label faecal microbiota transplantation (Blautia spp, Dorea spp, Ruminococcus, and Clostridium cluster XVIII). Both Fusobacterium spp and Sutterella spp were associated consistently with no remission in patients who had double‐blind and open‐label faecal microbiota transplantation."

"The study sequenced the V1 through V3 region of 16S rRNA gene using MiSeq Illumina technology. Microbiota analysis and curation were performed utilizing mothur, and altered members of the microbiota were identified using the biomarker discovery algorithm linear discriminant analysis Effect Size (LEfSe). Shotgun metagenomics sequencing was also performed in subsequent follow‐up studies. The authors performed RNA extraction to ensure that bacteria detected in their analyses were live and active bacteria. Microbiota analyses were done on 70 patients (314 fecal samples) and 113 donor fecal samples; 55 individual donors were used and 58 batched donor samples. The microbiota of donors was analyzed along with patients receiving individual or batched dFMTs. For recipients, the microbiota composition was analyzed prior to and following FMT, and patients were binned into responders and non‐responders. The microbiota of batched donor samples showed higher phylogenetic diversity than individual donors, and overall donor samples had higher diversity than baseline samples from patients with IBD. After four and eight weeks, patients receiving FMT saw an increase in phylogenetic diversity in the microbiota compared to baseline. LEfSe analysis determined that 295 microbial taxa were differentially altered following transplant and 78 of these members showed high linear discriminant analysis scores (>3). Interestingly, regardless of clinical outcome, the authors observed decreased abundance of operational taxonomic units (OTUs) affiliated with the Bacteroides genera and increased abundance of OTUs affiliated with the Prevotella genera. The authors further describe that FMT was associated with increased diversity in all patients. Importantly, recipients who achieved a successful primary outcome had greater richness in OTUs at baseline, during fecal microbiota transplantation and at 8 weeks. Finally, the authors performed LEfSe analysis comparing patients who responded to non‐responders; 87 Taxa were associated with primary outcomes in masked patients and 46 were associated with open‐label patients. Remission was associated with taxa with Barnsiella, Parabacteroides, Clostridium cluster IV and Ruminococcus. Moreover, Fusobacterium and Sutterella were associated with a lack of remission in all patients."

Rossen 2015

UC

Human Intestinal Tract chip (HITchip) phylogenetic microarray

"At 12 weeks after treatment, 16 samples were available from FMT‐D patients and 18 FMT‐A patients. The diversity index of responders in both groups increased significantly (from S = 5.61 ± 0.29 to S = 5.83 ± 0.15 in responders to FMT‐D (P = .06) and from S = 5.81 ± 0.07 to S = 6.03 ± 0.14 in responders to FMT‐A (P = .01)). The increase in diversity at week 12 could be attributed to an increase in both richness and evenness in all responders. Diversity in nonresponders did not change over time."

Not reported

"Redundancy analysis showed that the microbiota composition of responders in the FMT‐D group shifted from overlap with nonresponders at baseline to healthy donors at week 12. This shift was mainly explained by a regain of Clostridium clusters IV, XIVa, and XVIII, and reduction in Bacteroidetes. Notably, changes in Faecalibacterium prausnitzii (from 8.00 ± 5.72 at baseline to 8.37 ± 5.10 at week 12; P = .68), which belongs to Clostridium cluster IV, did not play a role in this increased abundances in our study subjects. Responders to FMT‐A shifted away from nonresponders, but in a different direction than responders to FMT‐D. This shift was mostly associated with an increase in abundance of Bacilli, Proteobacteria, and Bacteriodetes."

"The study used the Human Intestinal Tract chip (HITchip) phylogenetic microarray, to perform microbiome diversity analysis. The study compared microbiota profiles of donors and patients with UC. Moreover, this study characterized microbiota profiles prior to and following FMT with donor stool or FMT with autologous stool. Finally, responders and non‐responders for each FMT group were compared. Microbiome analysis with HITchip showed that microbiota profiles and diversity indexes of patients with UC was different than healthy donors. This was highlighted by enrichment in taxa belonging to the Bacteroidetes, Proteobacteria, Bacilli, and Clostridium clusters IX and XI and decreased levels of Clostridium IV, IXIVa, and XVIII compared to donors." "Following FMT with both donor stool and autologous stool, diversity increased in responders and did not increase in non‐responders. Shifts in the community taxa of responders could be observed in both donor and autologous FMTs. However, the shift between these two responder groups was distinct. Microbiota of FMT responders from donors were highlighted by increases in taxa belonging to the Clostridium IV, XIVa, and IVIII groups. Alternatively, the microbiota of responders that received autologous FMT was highlighted by an increase in Bacilli, Proteobacteria, and Bacteroidetes. Correlation analysis further revealed that microbiota of responding recipients showed increased similarity to donor microbiota following FMT. Importantly, no shifts in microbiota were observed in non‐responders."

Costello 2019

UC

Not reported

Not reported

Not reported

Association with increased abundance following dFMT:

  • Peptococcus niger

  • Faecalicoccus pleomorphus

  • Olsenella sp.

  • Acidaminococcus intestini

  • Senegalimassilia anaerobia

  • Prevotella copri

  • Methanobrevibacter smithii

  • Clostridium methylpentosum

  • Alistipesindistinctus

  • Slackia isoflavoniconvertens

  • Odoribacter splanchnicus

Association with reduced abundance following dFMT:

  • Anaerostipescaccae

  • Gordonibacter pamelaeae

  • Clostridium aldenense

Studied changes in fecal‐associated microbiota following FMT by 16S ribosomal RNA sequencing, stratified by both change in total Mayo score following FMT and randomization. The durability of engraftment of these species acquired following dFMT was assessed by quantifying these species at 12 months. The V4 hypervariable region of the 16S ribosomal RNA gene was amplified and raw sequencing data processed into operational taxonomic units at 97% similarity in stool samples from individual donors, pooled stool batches, and FMT recipients taken at weeks 0, 4, 8, and 52.

At baseline, blended donor stool showed the most microbial diversity (measured by operational taxonomic units) followed by individual donor stool then stool of patients with UC. Diversity increased following dFMT compared with aFMT at weeks 4 and 8. There was no significant association between change in total Mayo score following dFMT and baseline diversity (β = 0.6 [95% CI, −4.8 to 5.9]; P= .84) nor change in diversity at week 8 (β = −20.3 [95% CI, −50.7 to 11.2]; P = .23).

The 10 bacteria and the archaea Methanobrevibacter smithii whose increased abundance were most strongly associated with dFMT at weeks 4 and 8 were all anaerobic. The abundance of these organisms remained relatively stable from weeks 4 to 8; however, by 12 months, there was variability in abundance of many of these organisms. Increased abundance of Anaerofilum pentosovorans and Bacteroides coprophilus species was strongly associated with disease improvement following dFMT.

Crothers 2021

UC

MoBio Powersoil 96 kit

"Measures of microbial alpha

diversity (Shannon index) between subjects and donor samples, and to their own baseline samples, were calculated.

No difference in alpha diversity was observed between treatment groups at baseline. FMT did not increase alpha (Shannon) diversity in recipients but did lead to community‐level changes in the gut microbiota creating measurable similarity (beta diversity, Jensen‐Shannon divergence index) between FMT subjects and their donor."

"Measures of microbial beta diversity (Jensen‐
Shannon divergence) between subjects and donor samples, and to their own baseline samples, were calculated.

No difference in beta diversity was observed between treatment groups at baseline. FMT did not increase alpha (Shannon) diversity in recipients but did lead to community‐level changes in the gut microbiota creating measurable similarity (beta diversity, Jensen‐Shannon divergence index) between FMT subjects and their donor."

"Across all time points, stool samples were dominated at the phylum level by Firmicutes, and Bacteroidetes, which accounted for 88.90% of all sequence reads. Bacteria present at lower proportions included Proteobacteria, and Actinobacteria, accounting for 6.9% and 4.0% of total reads, respectively. At the genus level, samples were dominated by Clostridiales and Bacteroidales, with

a lower proportion of Burkholderiales, Bifdobacteriales, Selenomonadlaes, Enterobacteriales, Lactobacillales observed at various time points."

DNA extraction was performed using the MoBio Powersoil 96 kit with minor modifications and 16S rRNA gene libraries targeting the V4 region of the 16S rRNA gene were prepared. Each sample was given a unique reverse barcode and replicates were then pooled, cleaned and normalized prior to sequencing on an Illumina MiSeq 300. Raw sequence reads were then processed and OTU calling performed using the Qiime2—dada pipeline. Measures of microbial alpha diversity (Shannon index) and beta diversity (JensenShannon divergence) between subjects and donor samples, and to their own baseline samples, were calculated.

No difference in alpha or beta diversity was observed between treatment groups at baseline. FMT did not increase alpha (Shannon) diversity in recipients but did lead to community‐level changes in the gut microbiota creating measurable similarity (beta diversity, JensenShannon divergence index) between FMT subjects and their donor. This convergence, which we termed ‘Donor Divergence Index’, remained statistically significant through 8 weeks of dosing weeks following cessation of oral cFMT therapy

Fang 2021

UC

Illumina MiSeq

"Alpha diversity index calculation was performed with abundance indexes (Chao1 and ACE) and diversity indexes (Shannon and Simpson). The

alpha diversity index of the fecal microbiota in active UC

patients, healthy donors and patients after FMT treatment showed no significant difference."

"The beta

diversity of the samples was measured using the Bray‐
Curis distance based on an evenly rarefied OTU abundance table. Statistical differences in measured β‐diversity metrics across groups were

determined using PERMANOVA with 999 permutations,
using adonis in the R package vegan. Shared OTUs were

calculated and visualized using the R package Venn diagram.

To measure the level of similarity between gut microbial

communities, analysis of similarities (ANOSIM) was performed. The data revealed an apparent separation in the structure of the gut microbiota in each group. Principal coordinate analysis (PCoA) was used to
indicate the similarity of the microbiota composition

among samples. PCoA revealed that the gut microbiota in people with UC significantly deviated from that in healthy donors. Treatment with FMT improved the
distance markedly, and the samples clustered tightly
together, showing a trend similar to that of their related
donors, but did not return to the level of healthy donors."

"The taxonomic profiles

showed that the phyla Bacteroidetes, Firmicutes and Proteobacteria were dominant bacteria in the fecal microbiota of healthy donors and active UC patients. The relative abundance of Bacteroidetes was significantly decreased and that of Proteobacteria was significantly increased in active UC patients. Firmicutes showed no significant changes among healthy donors and active UC patients. Compared with healthy donors, patients with active UC showed an increased ratio of Firmicutes and Bacteroidetes. Single fresh FMT could significantly reconstruct the dysbiotic gut microbiota and maintain stability, with an increased proportion of Bacteroidetes and a decreased proportion of Proteobacteria. At the genus level, some specific bacterial biomarkers were identified. The relative abundance of Escherichia was significantly increased in active UC patients and was significantly decreased after FMT. A high abundance of Prevotella was found in the donor gut. FMT‐treated patients who achieved remission also tended to have a higher abundance of Prevotella.

Taxonomic phylum profiles of the gut microbiota among healthy donors, active UC patients and patients
post‐FMT treatment:

  • Bacteroidetes

  • Firmicute

  • Proteobacteria

Prevotella was the dominant genus in the gut microbiota of the healthy donors, and the relative abundance of Prevotella increased after FMT treatment in active UC patients"

"The gut microbiota was assessed by 16S ribosomal RNA sequencing. The V3–V4 hypervariable region of the 16S rRNA gene was amplified via high‐throughput sequencing on the Illumina MiSeq platform, and the raw sequencing data from stool samples from individual donors and FMT recipients pre‐ and post‐FMT treatment were processed into operational taxonomic units at 97% similarity."

"The alpha diversity index of the fecal microbiota in active UC patients, healthy donors and patients after FMT treatment showed no significant difference.

Principal coordinate analysis (PCoA) was used to indicate the similarity of the microbiota composition among samples. PCoA revealed that the gut microbiota in UC patients significantly deviated from that in healthy donors. Treatment with FMT improved the distance markedly, and the samples clustered tightly together, showing a trend similar to that of their related donors, but did not return to the level of healthy donors. The system clustering tree also indicated that a significant difference existed between UC patients and healthy donors.

Linear discriminant analysis effect size (LEfSe) was used to identify differential microorganism communities between groups. The taxonomic profiles showed that the phyla Bacteroidetes, Firmicutes and Proteobacteria were dominant bacteria in the fecal microbiota of healthy donors and active UC patients. The relative abundance of Bacteroidetes was significantly decreased and that of Proteobacteria was significantly increased in people with active UC patients. Firmicutes showed no significant changes among healthy donors and active UC patients. Compared with healthy donors, patients with active UC showed an increased ratio of Firmicutes and Bacteroidetes. Single fresh FMT could significantly reconstruct the dysbiotic gut microbiota and maintain stability, with an increased proportion of Bacteroidetes and a decreased proportion of Proteobacteria. At the genus level, some specific bacterial biomarker were identified. The relative abundance of Escherichia was significantly increased in active UC patients and was significantly decreased after FMT. A high abundance of Prevotella was found in the donor gut. FMT‐treated patients who achieved remission also tended to have a higher abundance of Prevotella."

"The PICRUSt tool was used to predict the functional profiles of gut microbiota with the predicted metagenome, and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway functions were categorized using PICRUSt. PICRUSt predicted analyses found that the gut microbiota pathway functions showed that several pathways in gut microbiome among the donor and pre and post FMT treatment changed significantly, especially the pathways of pyruvate metabolism, sulfur metabolism, pantothenate and CoA biosynthesis, glyoxylate and dicarboxylate metabolism, synthesis and degradation of ketone bodies and other transporters were significantly different between the groups."

Pai 2021

UC

Not reported

Not reported

"Beta‐Diversity trended higher from baseline to week 6 in FMT vs placebo arms"

"Several bacterial taxa were associated with achieving the composite clinical outcome after multiple test correction, including Alistipes spp and Escherichia spp"

"Microbial community profiling in fecal samples was performed centrally at McMaster Children's Hospital. We extracted genomic DNA from patient and donor stool samples using a protocol previously described"

"Beta‐Diversity trended higher from baseline to week 6 in FMT vs placebo arms. Several bacterial taxa were associated with achieving the composite clinical outcome after multiple test correction, including Alistipes spp and Escherichia spp"

Březina 2021

UC

Ion Torrent PGM platform with an Ion 316 Chip Kit v2 BC using an Ion PGM Hi‐Q View Sequencing Kit (ThermoFisher Scientific)

"The analysis of bacterial diversity was assessed through alpha diversity (Chao1, evenness,
Faith's phylogenetic diversity, and Shannon index)." "Alpha diversity, which evaluates the species richness and evenness; Faith's phylogenetic distance; and Shannon diversity showed no significant differences between the FMT and 5‐ASA treatment groups, nor between the responder and non‐responder subgroups inside each cohort."

"The analysis of bacterial diversity was assessed through beta diversity (Jaccard's distance metric) using
the Qiime2 pipeline." "Beta diversity, which evaluates the similarity of bacterial communities among samples,
was assessed using Jaccard's non‐phylogenetic distance matrix. As early as 2 weeks after the therapy initiation, the authors could differentiate responders from non‐responders in both the FMT group
(PERMANOVA p = 0.001, PERMDISP p = 0.100) and 5‐ASA group (PERMANOVA p = 0.003,
PERMDISP p = 0.099)."

"In total, 9 phyla, 142 genera, and 184 species were detected in the samples of UC patients. Firmicutes (41–94%) were detected as the dominant phylum in all samples, regardless of treatment, except for one sample (19%) from the FMT group at the baseline, in which Proteobacteria (52%) were flourishing. The second most abundant were Actinobacteria (1–38%), and/or Bacteroidetes (1–37%). Firmicutes were mainly represented by the order Clostridiales; Bacteroidetes were mainly represented by the order Bacteroidales; and in Actinobacteria, the order Bifidobacteriales predominated. Other phyla including Fusobacteria, Tennericutes, Acidobacteria, Planctomyceles, and TM7 were detected with low frequencies (≤0.4%). The donor stool was dominated by Firmicutes, with a prevalence of the families Lachnospiraceae (67%) and Ruminococcaceae (17%). The relative abundance of Actinobacteria (1%) and Bacteroidetes (2%) was quite low, represented by the family Coriobacteriaceae and the families Prevotellaceae and Bacteroidaceae, respectively. F. prausnitzii was present with a frequency of 3% in the stool of the donor."

"The amplification of the bacterial variable V4‐V5 region of 16S rRNA was performed according to Fliegerova et al using EliZyme HS Robust MIX Red (Elisabeth Pharmacon) and 10 µM of each primer (forward: GGATTAGATACCCTGGTAGT, reverse: CACGACACGAGCTGACG). The thermal cycling conditions included initial denaturation for 10 min at 95 ◦C followed by 30 cycles of 30 s at 95 ◦C, 30 s at 57 ◦C, and 30 s at 72 ◦C. PCR amplicons (≈300 bp [base pairs]) were purified and libraries were prepared using the NEBNext Fast DNA Library Prep Set for Ion Torrent (New England BioLabs) and Ion Xpress Barcode Adapters 1–96 Kit (ThermoFisher Scientific). Libraries were consequently pooled, with their equimolar concentration determined with a KAPA Library Quantification Kit (KAPA Biosystems). The sequencing template was prepared in a One Touch 2 instrument using an Ion PGM OT2 HiQ View Kit (ThermoFisher Scientific). HTS was performed in an Ion Torrent PGM platform with an Ion 316 Chip Kit v2 BC (ThermoFisher Scientific) using an Ion PGM Hi‐Q View Sequencing Kit (ThermoFisher Scientific), according to the manufacturer's protocols"

"A non‐significant increase was detected in Shannon diversity index, for both responders and non‐responders, 2 weeks after both therapy types compared to the baseline (Figure S2). A higher Shannon index was still observed when more samples from different sampling points after therapy initiation were included in the calculation, indicating that FMT and 5‐ASA can, to a certain extent, influence the microbial alpha diversity of UC patients."

Sarbagili Shabat 2022

UC

Next‐generation sequencing libraries were prepared

using Nextera DNA library prep [Illumina] and sequenced on a
NovaSeq sequencing platform [Illumina]

Did not detect any postdiet microbial shift in alpha diversity in FMT donors.

Not reported

Not reported

The authors performed donor microbiome analysis following and did not report on the recipient's. "Metagenomic DNA was purified using DNeasy PowerMag Soil DNA extraction kit [Qiagen] optimised for Tecan automated platform. Next‐generation sequencing [NGS] libraries were prepared using Nextera DNA library prep [Illumina] and sequenced on a NovaSeq sequencing platform [Illumina]. Sequencing was performed with 75‐bp single‐end reads with the depth of 10 million reads per sample. We filtered metagenomic reads containing Illumina adapters, filtered low quality reads, and trimmed low‐quality read edges. We detected host DNA by mapping with Bowtie to the human genome with inclusive parameters, and removed those reads. Bacterial relative abundance [RA] estimation was performed by mapping bacterial reads to species‐level genome bins [SGB] representative genomes. We selected all SGB representatives with at least 5 genomes in a group, and for these representatives' genomes kept only unique regions as a reference dataset. Mapping was performed using Bowtie and abundance was estimated by calculating the mean coverage of unique genomic regions across the 50% most densely covered areas. Bacterial richness declined in 5/7 donors examined. They did not detect any post‐diet microbial shift, including in alpha diversity."

Sokol 2020

CD

MiSeq Illumina

"The authors observed a significant increase in alpha diversity following FMT but not sham"

"The similarity of the fecal microbiota samples was assessed using the Sorensen similarity index (Sorensen similarity index = [1 – Bray Curtis dissimilarity index])." "No statistically significant difference was observed between the FMT and sham group at week 6."

"The authors identified several taxa associated with flare, including many taxa belonging to the Gammaproteobacteria class and the Clostridiales order comprising Ruminococcus gnavus. In addition, we also observed taxa associated with maintenance of remission, such as Ruminococcaceae, Coprococcus, and Desulfovibrio genus."

"The similarity of the fecal microbiota samples was assessed using the Sorensen similarity index (Sorensen similarity index = [1 – Bray Curtis dissimilarity index])"

"We observed a significant increase in alpha diversity following FMT but not sham"

"We then looked at the similarity between donor and recipient microbiota using the Sorensen index. No statistically significant difference was observed between the FMT and sham group at week 6."

aFMT: autologous fecal microbiota transplantation; CD: Crohn disease; CRP: C‐reactive protein; dFMT: donor fecal microbiota transplantation; EQ‐5D: EuroQol Five‐Dimensions Questionnaire; ESR: erythrocyte sedimentation rate; FMT: fecal microbiota transplantation; IBDQ: Inflammatory Bowel Disease Questionnaire; SCCAI: Simple Clinical Colitis Activity Index; UC: ulcerative colitis.

Comparison 2: fecal microbiota transplantation for maintenance of remission in ulcerative colitis

Primary outcomes
Maintenance of clinical remission in ulcerative colitis at longest follow‐up

Two studies assessed FMT for maintenance of remission in 71 participants with UC, all of whom had achieved remission with FMT before randomization to the FMT versus control groups (Haifer 2022Sood 2019a). The evidence was very uncertain about the effect of FMT on maintenance of clinical remission in participants with UC (RR 2.97, 95% CI 0.26 to 34.42; very low‐certainty evidence; Analysis 2.1). We downgraded the certainty of evidence due to risk of bias, inconsistency, and very serious imprecision (summary of findings Table 2).

Sensitivity analyses

A sensitivity analysis using a fixed‐effect model showed that FMT may lead to a small increase in rates of maintenance of remission in participants with controlled UC (RR 1.53, 95% CI 1.13 to 2.07; Analysis 2.2). A sensitivity analysis based on participants who completed follow‐up showed similar results (RR 1.66, 95% CI 0.47 to 5.81; Analysis 2.3).

Publication bias and subgroup analyses

The number of studies was fewer than 10, so we did not draw funnel plots for publication bias or perform subgroup analyses.

Serious adverse events

Two studies reported no serious adverse events in 71 participants with UC for whom FMT was used for maintenance of remission (Analysis 2.4). Overall, the evidence was very uncertain (summary of findings Table 2). We downgraded the certainty of evidence due to risk of bias and very serious imprecision.

Publication bias, subgroup analyses, and sensitivity analyses

None of the subgroup or sensitivity analyses were performed as the number of events was zero in both studies. The funnel plot was not drawn because there were fewer than 10 studies.

Secondary outcomes
Any adverse events

The data from two studies showed very uncertain evidence about the risk of any adverse events when FMT was used for maintenance of remission in UC (RR 1.16, 95% CI 0.85 to 1.59; very low‐certainty of evidence; Analysis 2.5). We downgraded the certainty of evidence due to risk of bias and very serious imprecision (summary of findings Table 2).

Maintenance of endoscopic remission in ulcerative colitis at longest follow‐up

The evidence was very uncertain about the use of FMT for maintenance of remission in people with UC (RR 3.28, 95% CI 0.73 to 14.74; very low‐certainty evidence; Analysis 2.6). We downgraded the certainty of evidence due to risk of bias and very serious imprecision (summary of findings Table 2).

Quality of life at longest follow‐up

Haifer 2022 reported quality‐of‐life (IBDQ) scores after use of FMT for maintenance of remission in people with UC and the evidence was very uncertain, so no conclusive statement could be made (MD 38.2, 95% CI 19.3 to 57.1; 10 participants; very low‐certainty evidence). The data in this study were reported in such a way that an effect size could not be calculated. We downgraded the certainty of evidence due to risk of bias and very serious imprecision (summary of findings Table 2).

Withdrawals in studies on maintenance of remission in ulcerative colitis

There was little to no difference in withdrawal rates between the FMT and control groups after use of FMT for maintenance of remission in UC (RR 0.30, 95% CI 0.05 to 1.73; 2 studies, 71 participants; Analysis 2.7).

Erythrocyte sedimentation rate at longest follow‐up

One study reported low levels of ESR at the end of follow‐up after use of FMT for maintenance of remission in UC (MD −10.40 mm/hour, 95% CI −12.54 to −8.26; 61 participants; Analysis 2.8).

C‐reactive protein at longest follow‐up

One study reported low levels of CRP at the end of follow‐up after use of FMT for maintenance of remission in UC (MD −2.70 mg/L, 95% CI −3.82 to −1.58; 61 participants; Analysis 2.9).

Microbiome outcomes

Table 1 provides the summary of methods used to assess microbiome‐related outcomes and the summary of key findings.

Comparison 3: fecal microbiota transplantation for induction of remission in Crohn disease

None of the included studies reported data on use of FMT for induction of remission in CD.

Comparison 4: fecal microbiota transplantation for maintenance of remission in Crohn disease

Primary outcomes
Maintenance of clinical remission in Crohn disease at longest follow‐up

One study reported data on maintenance of remission in people with CD after FMT versus control (Sokol 2020). The evidence was very uncertain and no conclusive statement could be made about the use of FMT for maintenance of remission in CD (RR 1.21, 95% CI 0.36 to 4.14; 21 participants; very low‐certainty of evidence; Analysis 4.1summary of findings Table 4).

Serious adverse events

One study of 21 participants reported 13 serious adverse events in people with CD (Sokol 2020). However, the paper did not specify an exact breakdown of events between the FMT and control groups that totaled 13 events, so we did not calculate an effect size from these data. Overall, the evidence was very uncertain and no conclusive statement could be made about the risk of serious adverse events with FMT in people with CD (summary of findings Table 4).

Secondary outcomes
Any adverse events

One study of 21 participants provided examples of adverse events experienced by participants, but the total number of any adverse events and corresponding breakdown between the FMT and control groups were not specified (Sokol 2020). It was also unclear whether the events reported were per person or if one participant experienced more than one event. Therefore, we did not calculate an effect size from these data. Overall, the evidence was very uncertain and no conclusive statement could be made about the risk of any adverse events with FMT in people with CD (summary of findings Table 4).

Quality of life at longest follow‐up

No studies reported data on quality of life (IBDQ scores) in people with CD.

Withdrawals in studies on maintenance of remission in Crohn disease

In one study, the withdrawal rate was 54.5% (6/11) in the FMT group versus 40.0% (4/10) in the control group (RR 1.36, 95% CI 0.54 to 3.46; 21 participants; Analysis 4.2).

Erythrocyte sedimentation rate at longest follow‐up

No studies reported ESR levels after use of FMT in people with CD.

C‐reactive protein at longest follow‐up

One study reported CRP levels at six weeks after use of FMT as median values, which were lower in the FMT group (median 3.0 mg/L, IQR 3.0 to 14.2) than the control group (median 6.9 mg/L, IQR 4.0 to 8.7; Sokol 2020).

Fecal calprotectin at longest follow‐up

One study reported FC levels at six weeks after use of FMT and the results were similar between the FMT and control groups (Sokol 2020).

Microbiome outcomes

Table 1 provides the summary of methods used to assess microbiome‐related outcomes and the summary of key findings.

Discussion

Summary of main results

This review synthesized findings from 11 studies that assessed FMT for treatment of UC and one study that assessed FMT for treatment of CD. Eight new studies were added to this updated version of our previous review (Imdad 2018).  FMT may increase the rates of clinical and endoscopic remission in people with active UC, with little to no difference in any adverse events. The evidence was very uncertain about the risk of serious adverse events and improvement in quality of life when FMT was used for control of active UC. The evidence was also very uncertain about the use of FMT for maintenance of remission in UC and for both induction and maintenance of remission in CD.

Overall completeness and applicability of evidence

In this update, we added eight studies of participants with UC, which contributed to the analyses of FMT for induction of clinical remission, induction of endoscopic remission, serious adverse events, any adverse events, clinical response, endoscopic response, and quality of life. The addition of new data increased the overall number of events and size of the study population, which improved the precision of the summary estimates. However, the summary estimate was still very wide for most outcomes and the lower intervals of CIs around the summary estimate either showed a very small effect or crossed the null effect. More data will be required before the efficacy and safety of FMT for treatment of IBD can be established. It is important to note that the FDA issued safety alerts related to the use of FMT and risk of serious adverse events, including the transfer of multiple drug‐resistant organisms, SARS‐CoV‐2 transmission, and mortality (FDA 2020aFDA 2020b).

Most studies included in this review assessed the use of FMT for induction of remission in people with active UC and showed low‐certainty evidence that FMT may increase rates of clinical and endoscopic remission. The potential benefit of FMT for treatment of UC seems to be biologically plausible, based on earlier observations suggesting that people with UC have dysbiosis of the gut (Bejaoui 2015Kostic 2014Vindigni 2016), and that those who respond to FMT demonstrate reversal of this dysbiosis (Costello 2019Paramsothy 2017). In addition, other therapeutic agents that target the microbiome, such as probiotics, have demonstrated efficacy in maintenance of remission in UC (Kaur 2020). A causal association between dysbiosis and UC seems to be further supported by the studies in this review, as microbiome analyses suggested differential responses in the microbiota of responders versus non‐responders, highlighted by a shift towards the donor community microbiota in FMT responders (Crothers 2021Moayyedi 2015Paramsothy 2017Rossen 2015Sokol 2020). Notably, Paramsothy 2017 was also able to identify several taxa that were associated with induction of remission and the presence of other taxa that were associated with a lack of effect. Similarly, increased alpha diversity was associated with increased likelihood of a positive response.

Most of the participants with active UC in the included studies had mild‐to‐moderate UC, and it is not clear whether the efficacy would be similar, better, or worse in participants with severe UC. Also, it is not clear whether a combination of interventions, such as the use of antibiotics, nutritional therapy, or probiotics with FMT, has advantages over FMT alone. Furthermore, all the studies on active UC included participants who have failed at least one drug and none of the participants were treatment‐naive.

There was notable clinical heterogeneity in the use of FMT among participants with active UC in terms of route, dosage, frequency, donor type, and pooling of stool from multiple donors. We updated the subgroup analyses for people with UC, but the number of studies in each subgroup analysis remained small, so no conclusive statement could be made about a differential effect of FMT on induction of clinical remission in UC based on age, route, frequency, or donor.

The number of studies on FMT for treatment of CD was small, and no conclusive statement could be made about the use of FMT for induction or maintenance of remission in CD.

Quality of the evidence

In the previous version of this review (Imdad 2018), the certainty of the evidence for most outcomes was low. With the addition of eight new studies to the analysis on induction of remission among participants with active UC, the evidence remained of low certainty for most outcomes. The most common reasons for downgrading the certainty of the evidence were risk of bias and imprecision due to a low number of studies and participants in a given analysis. Even though the overall precision of the summary estimate improved with the addition of new studies, the variation of effect around the summary estimate included a possibility of little or no effect. For example, the risk difference for the effect of FMT on induction of clinical remission in UC was about 15%; however, the lower limit of the CIs showed a risk difference of only 5%, which might not be clinically meaningful. We considered a minimal important difference of at least 10% to 15% for induction of remission in people with active UC, which is a conservative target compared to those of other trials on treatment of IBD (Bahnam 2023Gordon 2021). We might revise our certainty assessment with the addition of newer studies in future updates.

We prioritized five outcomes to be included in the summary of findings tables in this version of the review, compared to seven outcomes included in the last version of the review. We included quality‐of‐life scores and excluded clinical and endoscopic response from the summary of findings tables based on the clinical importance of these outcomes. We generated separate summary of findings tables for induction and maintenance of remission in each subtype of IBD. We think that this approach is clinically meaningful for clinicians to access the most up‐to‐date evidence‐based information on use of FMT for induction and maintenance of remission in UC and CD. As the body of evidence on this topic grows, more data will be reported in these tables, especially as we noted 29 ongoing studies.

Potential biases in the review process

This review was conducted following the standardized methods of Cochrane. We searched for both published and ongoing studies, and two review authors extracted data from each published study. In the previous version of this review, we had aimed to include non‐randomized cohort studies with control arms, but no such studies were available. In this update, we did not consider any observational studies and only included randomized trials.

Three included studies were stopped early due to futility issues (Moayyedi 2015Rossen 2015Sarbagili Shabat 2022), and one trial enrolled approximately half of its goal participant number (Pai 2021). One trial was discontinued because the primary endpoint, remission of UC, was deemed unlikely to be achieved by the institution's Data Monitoring and Safety Board (DMSB), but enrolled participants were allowed to complete the trial (Moayyedi 2015). Similarly, another trial was advised by its DMSB to terminate early due to serious adverse events, less‐than‐expected treatment effect, and the need to expand its sample size uncovered during interim analysis (Rossen 2015). This study collected three months of data prior to its termination and an ITT analysis of its reported outcomes has been included in the current review. A third trial was also stopped early by the DMSB upon review of interim data after more than half of the intended participants had been enrolled (Sarbagili Shabat 2022). However, the Cochrane Handbook for Systematic Reviews of Interventions guidelines do not consider these studies to be at high risk of bias (Higgins 2011).

There is a debate on which outcome is most important to define the efficacy of an intervention for induction of remission in people with IBD (Armuzzi 2012Auzoux 2017Dave 2012Dulai 2015Peyrin‐Biroulet 2011). The most commonly used outcome is 'clinical remission,' which is based on clinical symptom scores. The literature has suggested the need to assess mucosal healing as part of the response to therapy in IBD, as it might better predict long‐term outcomes, including the risk of surgery (Auzoux 2017De Preter 2012Dulai 2015). In the protocol (Imdad 2017) of the first published version of this review (Imdad 2018), we had decided a priori that the primary outcome of 'clinical remission' would be based on definitions derived from clinical scores. In this updated version of the review, we updated the same analysis but also considered composite outcomes, if available, and results continued to favor FMT versus control for induction of remission in people with active UC (Analysis 1.10). Therefore, we consider that the observed effect of FMT on induction of remission in people with active UC seems to hold regardless of how remission is defined.

We conducted ITT analyses with the assumption that all participants who were randomized to a group would be analyzed in the same group irrespective of whether they received the intervention or completed follow‐up. Participants lost to follow‐up were considered to have experienced treatment failure in both the intervention and control groups. Some experts advocate for analysis of only those participants who completed follow‐up to avoid attrition bias. Thus, we performed a post‐hoc sensitivity analysis using available cases, which had similar results for the use of FMT for induction of clinical remission in people with active UC (Analysis 1.9).

Agreements and disagreements with other studies or reviews

Since the publication of the original version of this review (Imdad 2018), multiple meta‐analyses have been published on the safety and efficacy of FMT for treatment of either UC or CD (Caldeira 2020Fehily 2021Zhao 2020). The systematic reviews on use of FMT for induction of remission in people with UC mirrored the results noted in our review (Caldeira 2020Zhao 2020). However, these reviews also included single‐arm cohort studies that we did not include here. The systematic review on use of FMT for treatment of CD also included both RCTs and cohort studies (Fehily 2021). That review included two RCTs that we screened (Sokol 2020Yang 2020), of which we only included Sokol 2020 and excluded Yang 2020 because it compared use of FMT via gastroscopy versus colonoscopy but both groups received FMT, which did not qualify as an eligible comparison under our inclusion criteria. Overall, the results were similar in these RCTs, and no conclusive statements could be made about FMT for treatment of CD.

Study flow diagram.

Figuras y tablas -
Figure 1

Study flow diagram.

Risk of bias summary: review authors' judgements about each risk of bias item for each included study.

Figuras y tablas -
Figure 2

Risk of bias summary: review authors' judgements about each risk of bias item for each included study.

Forest plot of comparison: 1 Fecal microbiota transplantation (FMT) versus control for treatment of inflammatory bowel disease, outcome: 1.1 Induction of clinical remission in ulcerative colitis at longest follow‐up.

Figuras y tablas -
Figure 3

Forest plot of comparison: 1 Fecal microbiota transplantation (FMT) versus control for treatment of inflammatory bowel disease, outcome: 1.1 Induction of clinical remission in ulcerative colitis at longest follow‐up.

Funnel plot: FMT for induction of clinical remission for UC. The graph appears symmetrical.

Figuras y tablas -
Figure 4

Funnel plot: FMT for induction of clinical remission for UC. The graph appears symmetrical.

Forest plot of comparison: 1 Fecal microbiota transplantation versus control for participants with ulcerative colitis, outcome: 1.8 Serious adverse events.

Figuras y tablas -
Figure 5

Forest plot of comparison: 1 Fecal microbiota transplantation versus control for participants with ulcerative colitis, outcome: 1.8 Serious adverse events.

Funnel plot: serious adverse events for use of FMT for induction of remission in UC. The graph appears symmetrical.

Figuras y tablas -
Figure 6

Funnel plot: serious adverse events for use of FMT for induction of remission in UC. The graph appears symmetrical.

Comparison 1: Fecal microbiota transplantation (FMT) versus control for induction of remission in ulcerative colitis (UC), Outcome 1: Induction of clinical remission in UC at longest follow‐up

Figuras y tablas -
Analysis 1.1

Comparison 1: Fecal microbiota transplantation (FMT) versus control for induction of remission in ulcerative colitis (UC), Outcome 1: Induction of clinical remission in UC at longest follow‐up

Comparison 1: Fecal microbiota transplantation (FMT) versus control for induction of remission in ulcerative colitis (UC), Outcome 2: Induction of clinical remission in UC at 8 weeks

Figuras y tablas -
Analysis 1.2

Comparison 1: Fecal microbiota transplantation (FMT) versus control for induction of remission in ulcerative colitis (UC), Outcome 2: Induction of clinical remission in UC at 8 weeks

Comparison 1: Fecal microbiota transplantation (FMT) versus control for induction of remission in ulcerative colitis (UC), Outcome 3: Induction of clinical remission in UC at 12 weeks

Figuras y tablas -
Analysis 1.3

Comparison 1: Fecal microbiota transplantation (FMT) versus control for induction of remission in ulcerative colitis (UC), Outcome 3: Induction of clinical remission in UC at 12 weeks

Comparison 1: Fecal microbiota transplantation (FMT) versus control for induction of remission in ulcerative colitis (UC), Outcome 4: Induction of clinical remission in UC at longest follow‐up: subgroup analysis by route of administration

Figuras y tablas -
Analysis 1.4

Comparison 1: Fecal microbiota transplantation (FMT) versus control for induction of remission in ulcerative colitis (UC), Outcome 4: Induction of clinical remission in UC at longest follow‐up: subgroup analysis by route of administration

Comparison 1: Fecal microbiota transplantation (FMT) versus control for induction of remission in ulcerative colitis (UC), Outcome 5: Induction of clinical remission in UC at longest follow‐up: subgroup analysis by type of donor

Figuras y tablas -
Analysis 1.5

Comparison 1: Fecal microbiota transplantation (FMT) versus control for induction of remission in ulcerative colitis (UC), Outcome 5: Induction of clinical remission in UC at longest follow‐up: subgroup analysis by type of donor

Comparison 1: Fecal microbiota transplantation (FMT) versus control for induction of remission in ulcerative colitis (UC), Outcome 6: Induction of clinical remission in UC at longest follow‐up: subgroup analysis by age

Figuras y tablas -
Analysis 1.6

Comparison 1: Fecal microbiota transplantation (FMT) versus control for induction of remission in ulcerative colitis (UC), Outcome 6: Induction of clinical remission in UC at longest follow‐up: subgroup analysis by age

Comparison 1: Fecal microbiota transplantation (FMT) versus control for induction of remission in ulcerative colitis (UC), Outcome 7: Induction of clinical remission in UC at longest follow‐up: subgroup analysis by frequency of FMT

Figuras y tablas -
Analysis 1.7

Comparison 1: Fecal microbiota transplantation (FMT) versus control for induction of remission in ulcerative colitis (UC), Outcome 7: Induction of clinical remission in UC at longest follow‐up: subgroup analysis by frequency of FMT

Comparison 1: Fecal microbiota transplantation (FMT) versus control for induction of remission in ulcerative colitis (UC), Outcome 8: Induction of clinical remission in UC at longest follow‐up: sensitivity analysis using fixed‐effect model

Figuras y tablas -
Analysis 1.8

Comparison 1: Fecal microbiota transplantation (FMT) versus control for induction of remission in ulcerative colitis (UC), Outcome 8: Induction of clinical remission in UC at longest follow‐up: sensitivity analysis using fixed‐effect model

Comparison 1: Fecal microbiota transplantation (FMT) versus control for induction of remission in ulcerative colitis (UC), Outcome 9: Induction of clinical remission in UC at longest follow‐up: sensitivity analysis for available cases

Figuras y tablas -
Analysis 1.9

Comparison 1: Fecal microbiota transplantation (FMT) versus control for induction of remission in ulcerative colitis (UC), Outcome 9: Induction of clinical remission in UC at longest follow‐up: sensitivity analysis for available cases

Comparison 1: Fecal microbiota transplantation (FMT) versus control for induction of remission in ulcerative colitis (UC), Outcome 10: Induction of clinical remission in UC at longest follow‐up: composite of clinical score and endoscopic score

Figuras y tablas -
Analysis 1.10

Comparison 1: Fecal microbiota transplantation (FMT) versus control for induction of remission in ulcerative colitis (UC), Outcome 10: Induction of clinical remission in UC at longest follow‐up: composite of clinical score and endoscopic score

Comparison 1: Fecal microbiota transplantation (FMT) versus control for induction of remission in ulcerative colitis (UC), Outcome 11: Serious adverse events for induction of remission in UC

Figuras y tablas -
Analysis 1.11

Comparison 1: Fecal microbiota transplantation (FMT) versus control for induction of remission in ulcerative colitis (UC), Outcome 11: Serious adverse events for induction of remission in UC

Comparison 1: Fecal microbiota transplantation (FMT) versus control for induction of remission in ulcerative colitis (UC), Outcome 12: Serious adverse events for induction of remission in UC: subgroup analysis by route of administration

Figuras y tablas -
Analysis 1.12

Comparison 1: Fecal microbiota transplantation (FMT) versus control for induction of remission in ulcerative colitis (UC), Outcome 12: Serious adverse events for induction of remission in UC: subgroup analysis by route of administration

Comparison 1: Fecal microbiota transplantation (FMT) versus control for induction of remission in ulcerative colitis (UC), Outcome 13: Serious adverse events for induction of remission in UC: subgroup analysis by type of donor

Figuras y tablas -
Analysis 1.13

Comparison 1: Fecal microbiota transplantation (FMT) versus control for induction of remission in ulcerative colitis (UC), Outcome 13: Serious adverse events for induction of remission in UC: subgroup analysis by type of donor

Comparison 1: Fecal microbiota transplantation (FMT) versus control for induction of remission in ulcerative colitis (UC), Outcome 14: Serious adverse events for induction of remission in UC: subgroup analysis by age

Figuras y tablas -
Analysis 1.14

Comparison 1: Fecal microbiota transplantation (FMT) versus control for induction of remission in ulcerative colitis (UC), Outcome 14: Serious adverse events for induction of remission in UC: subgroup analysis by age

Comparison 1: Fecal microbiota transplantation (FMT) versus control for induction of remission in ulcerative colitis (UC), Outcome 15: Serious adverse events for induction of remission in UC: sensitivity analysis using fixed‐effect model

Figuras y tablas -
Analysis 1.15

Comparison 1: Fecal microbiota transplantation (FMT) versus control for induction of remission in ulcerative colitis (UC), Outcome 15: Serious adverse events for induction of remission in UC: sensitivity analysis using fixed‐effect model

Comparison 1: Fecal microbiota transplantation (FMT) versus control for induction of remission in ulcerative colitis (UC), Outcome 16: Serious adverse events for induction of remission in UC: sensitivity analysis for available cases

Figuras y tablas -
Analysis 1.16

Comparison 1: Fecal microbiota transplantation (FMT) versus control for induction of remission in ulcerative colitis (UC), Outcome 16: Serious adverse events for induction of remission in UC: sensitivity analysis for available cases

Comparison 1: Fecal microbiota transplantation (FMT) versus control for induction of remission in ulcerative colitis (UC), Outcome 17: Any adverse events for induction of remission in UC

Figuras y tablas -
Analysis 1.17

Comparison 1: Fecal microbiota transplantation (FMT) versus control for induction of remission in ulcerative colitis (UC), Outcome 17: Any adverse events for induction of remission in UC

Comparison 1: Fecal microbiota transplantation (FMT) versus control for induction of remission in ulcerative colitis (UC), Outcome 18: Induction of endoscopic remission in UC at longest follow‐up

Figuras y tablas -
Analysis 1.18

Comparison 1: Fecal microbiota transplantation (FMT) versus control for induction of remission in ulcerative colitis (UC), Outcome 18: Induction of endoscopic remission in UC at longest follow‐up

Comparison 1: Fecal microbiota transplantation (FMT) versus control for induction of remission in ulcerative colitis (UC), Outcome 19: Quality of life (Inflammatory Bowel Disease Questionnaire [IBDQ]) scores at longest follow‐up for induction of remission in UC

Figuras y tablas -
Analysis 1.19

Comparison 1: Fecal microbiota transplantation (FMT) versus control for induction of remission in ulcerative colitis (UC), Outcome 19: Quality of life (Inflammatory Bowel Disease Questionnaire [IBDQ]) scores at longest follow‐up for induction of remission in UC

Comparison 1: Fecal microbiota transplantation (FMT) versus control for induction of remission in ulcerative colitis (UC), Outcome 20: Quality of life (IBDQ) scores at longest follow‐up for induction of remission in UC: sensitivity analysis without Haifer 2022

Figuras y tablas -
Analysis 1.20

Comparison 1: Fecal microbiota transplantation (FMT) versus control for induction of remission in ulcerative colitis (UC), Outcome 20: Quality of life (IBDQ) scores at longest follow‐up for induction of remission in UC: sensitivity analysis without Haifer 2022

Comparison 1: Fecal microbiota transplantation (FMT) versus control for induction of remission in ulcerative colitis (UC), Outcome 21: Induction of clinical response in UC at longest follow‐up

Figuras y tablas -
Analysis 1.21

Comparison 1: Fecal microbiota transplantation (FMT) versus control for induction of remission in ulcerative colitis (UC), Outcome 21: Induction of clinical response in UC at longest follow‐up

Comparison 1: Fecal microbiota transplantation (FMT) versus control for induction of remission in ulcerative colitis (UC), Outcome 22: Induction of endoscopic response in UC at longest follow‐up

Figuras y tablas -
Analysis 1.22

Comparison 1: Fecal microbiota transplantation (FMT) versus control for induction of remission in ulcerative colitis (UC), Outcome 22: Induction of endoscopic response in UC at longest follow‐up

Comparison 1: Fecal microbiota transplantation (FMT) versus control for induction of remission in ulcerative colitis (UC), Outcome 23: Withdrawals in studies on induction of remission in UC

Figuras y tablas -
Analysis 1.23

Comparison 1: Fecal microbiota transplantation (FMT) versus control for induction of remission in ulcerative colitis (UC), Outcome 23: Withdrawals in studies on induction of remission in UC

Comparison 1: Fecal microbiota transplantation (FMT) versus control for induction of remission in ulcerative colitis (UC), Outcome 24: Erythrocyte sedimentation rate (ESR) at longest follow‐up for induction of remission in UC (mm/hour)

Figuras y tablas -
Analysis 1.24

Comparison 1: Fecal microbiota transplantation (FMT) versus control for induction of remission in ulcerative colitis (UC), Outcome 24: Erythrocyte sedimentation rate (ESR) at longest follow‐up for induction of remission in UC (mm/hour)

Comparison 1: Fecal microbiota transplantation (FMT) versus control for induction of remission in ulcerative colitis (UC), Outcome 25: ESR at longest follow‐up for induction of remission in UC: sensitivity analysis without Moayyedi 2015 (mm/hour)

Figuras y tablas -
Analysis 1.25

Comparison 1: Fecal microbiota transplantation (FMT) versus control for induction of remission in ulcerative colitis (UC), Outcome 25: ESR at longest follow‐up for induction of remission in UC: sensitivity analysis without Moayyedi 2015 (mm/hour)

Comparison 1: Fecal microbiota transplantation (FMT) versus control for induction of remission in ulcerative colitis (UC), Outcome 26: C‐reactive protein (CRP) at longest follow‐up for induction of remission in UC (mg/L)

Figuras y tablas -
Analysis 1.26

Comparison 1: Fecal microbiota transplantation (FMT) versus control for induction of remission in ulcerative colitis (UC), Outcome 26: C‐reactive protein (CRP) at longest follow‐up for induction of remission in UC (mg/L)

Comparison 1: Fecal microbiota transplantation (FMT) versus control for induction of remission in ulcerative colitis (UC), Outcome 27: CRP at longest follow‐up for induction of remission in UC: sensitivity analysis without Moayyedi 2015 (mg/L)

Figuras y tablas -
Analysis 1.27

Comparison 1: Fecal microbiota transplantation (FMT) versus control for induction of remission in ulcerative colitis (UC), Outcome 27: CRP at longest follow‐up for induction of remission in UC: sensitivity analysis without Moayyedi 2015 (mg/L)

Comparison 1: Fecal microbiota transplantation (FMT) versus control for induction of remission in ulcerative colitis (UC), Outcome 28: Fecal calprotectin at longest follow‐up for induction of remission in UC (μg/mg)

Figuras y tablas -
Analysis 1.28

Comparison 1: Fecal microbiota transplantation (FMT) versus control for induction of remission in ulcerative colitis (UC), Outcome 28: Fecal calprotectin at longest follow‐up for induction of remission in UC (μg/mg)

Comparison 2: Fecal microbiota transplantation (FMT) versus control for maintenance of remission in ulcerative colitis (UC), Outcome 1: Maintenance of clinical remission in UC

Figuras y tablas -
Analysis 2.1

Comparison 2: Fecal microbiota transplantation (FMT) versus control for maintenance of remission in ulcerative colitis (UC), Outcome 1: Maintenance of clinical remission in UC

Comparison 2: Fecal microbiota transplantation (FMT) versus control for maintenance of remission in ulcerative colitis (UC), Outcome 2: Maintenance of clinical remission in UC: sensitivity analysis using fixed‐effect model

Figuras y tablas -
Analysis 2.2

Comparison 2: Fecal microbiota transplantation (FMT) versus control for maintenance of remission in ulcerative colitis (UC), Outcome 2: Maintenance of clinical remission in UC: sensitivity analysis using fixed‐effect model

Comparison 2: Fecal microbiota transplantation (FMT) versus control for maintenance of remission in ulcerative colitis (UC), Outcome 3: Maintenance of clinical remission in UC: sensitivity analysis for available cases

Figuras y tablas -
Analysis 2.3

Comparison 2: Fecal microbiota transplantation (FMT) versus control for maintenance of remission in ulcerative colitis (UC), Outcome 3: Maintenance of clinical remission in UC: sensitivity analysis for available cases

Comparison 2: Fecal microbiota transplantation (FMT) versus control for maintenance of remission in ulcerative colitis (UC), Outcome 4: Serious adverse events for maintenance of remission in UC

Figuras y tablas -
Analysis 2.4

Comparison 2: Fecal microbiota transplantation (FMT) versus control for maintenance of remission in ulcerative colitis (UC), Outcome 4: Serious adverse events for maintenance of remission in UC

Comparison 2: Fecal microbiota transplantation (FMT) versus control for maintenance of remission in ulcerative colitis (UC), Outcome 5: Any adverse events for maintenance of remission in UC

Figuras y tablas -
Analysis 2.5

Comparison 2: Fecal microbiota transplantation (FMT) versus control for maintenance of remission in ulcerative colitis (UC), Outcome 5: Any adverse events for maintenance of remission in UC

Comparison 2: Fecal microbiota transplantation (FMT) versus control for maintenance of remission in ulcerative colitis (UC), Outcome 6: Maintenance of endoscopic remission in UC

Figuras y tablas -
Analysis 2.6

Comparison 2: Fecal microbiota transplantation (FMT) versus control for maintenance of remission in ulcerative colitis (UC), Outcome 6: Maintenance of endoscopic remission in UC

Comparison 2: Fecal microbiota transplantation (FMT) versus control for maintenance of remission in ulcerative colitis (UC), Outcome 7: Withdrawals in studies on maintenance of remission in UC

Figuras y tablas -
Analysis 2.7

Comparison 2: Fecal microbiota transplantation (FMT) versus control for maintenance of remission in ulcerative colitis (UC), Outcome 7: Withdrawals in studies on maintenance of remission in UC

Comparison 2: Fecal microbiota transplantation (FMT) versus control for maintenance of remission in ulcerative colitis (UC), Outcome 8: Erythrocyte sedimentation rate (ESR) at longest follow‐up for maintenance of remission in UC (mm/hour)

Figuras y tablas -
Analysis 2.8

Comparison 2: Fecal microbiota transplantation (FMT) versus control for maintenance of remission in ulcerative colitis (UC), Outcome 8: Erythrocyte sedimentation rate (ESR) at longest follow‐up for maintenance of remission in UC (mm/hour)

Comparison 2: Fecal microbiota transplantation (FMT) versus control for maintenance of remission in ulcerative colitis (UC), Outcome 9: C‐reactive protein (CRP) at longest follow‐up for maintenance of remission in UC (mg/L)

Figuras y tablas -
Analysis 2.9

Comparison 2: Fecal microbiota transplantation (FMT) versus control for maintenance of remission in ulcerative colitis (UC), Outcome 9: C‐reactive protein (CRP) at longest follow‐up for maintenance of remission in UC (mg/L)

Comparison 4: Fecal microbiota transplantation (FMT) versus control for maintenance of remission in Crohn's disease (CD), Outcome 1: Maintenance of clinical remission in CD

Figuras y tablas -
Analysis 4.1

Comparison 4: Fecal microbiota transplantation (FMT) versus control for maintenance of remission in Crohn's disease (CD), Outcome 1: Maintenance of clinical remission in CD

Comparison 4: Fecal microbiota transplantation (FMT) versus control for maintenance of remission in Crohn's disease (CD), Outcome 2: Withdrawals in studies on maintenance of remission in CD

Figuras y tablas -
Analysis 4.2

Comparison 4: Fecal microbiota transplantation (FMT) versus control for maintenance of remission in Crohn's disease (CD), Outcome 2: Withdrawals in studies on maintenance of remission in CD

Summary of findings 1. Fecal microbiota transplantation compared to control for induction of remission in ulcerative colitis

Patient or population: people with active UC

Setting: inpatient or outpatient

Intervention: FMT

Comparison: control

Outcome

Anticipated absolute effects* (95% CI)

Relative effect (95% CI)

№ of participants
(studies)

Certainty of the evidence

What happens

Risk with control

Risk with FMT

Induction of clinical remission in UC at longest follow‐up (RR > 1 favors FMT)
Follow‐up: range 6–12 weeks

174 per 1000

312 per 1000
(197 to 494)

RR 1.79
(1.13 to 2.84)

468
(10 RCTs)

⊕⊕⊖⊖
Lowa,b,c

FMT may increase induction of clinical remission in UC at longest follow‐up.

Serious adverse events with use of FMT for induction of remission in UC (RR > 1 favors control)
Follow‐up: range 6–12 weeks

54 per 1000

95 per 1000
(47 to 190)

RR 1.77
(0.88 to 3.55)

468
(10 RCTs)

⊕⊝⊝⊝
Very lowa,d

The evidence is very uncertain about the effect of FMT on serious adverse events in people with UC.

Any adverse events with use of FMT for induction of remission in UC (RR > 1 favors control)
Follow‐up: range 6–12 weeks

455 per 1000

450 per 1000
(386 to 527)

RR 0.99
(0.85 to 1.16)

417
(9 RCTs)

⊕⊕⊖⊖
Lowa,e

FMT may result in little to no difference in any adverse events in people with UC.

Induction of endoscopic remission in UC at longest follow‐up (RR > 1 favors FMT)
Follow‐up: range 8–12 weeks

98 per 1000

143 per 1000
(63 to 324)

RR 1.45
(0.64 to 3.29)

285
(5 RCTs)

⊕⊕⊖⊖
Lowf,g,h

FMT may result in an increase in induction of endoscopic remission in UC at longest follow‐up; however, the CIs around the summary estimate were wide and included a possibility of no effect.

Quality‐of‐life scores: IBDQ with use of FMT for induction of remission in UC (MD > 0 favors FMT)
Follow‐up: range 8–12 weeks

The mean quality of life score: IBDQ was 150 QOL‐IBDQ score in control group

MD 15.34 QOL‐IBDQ scores higher
(3.84 lower to 34.52 higher)

131
(3 RCTs)

⊕⊝⊝⊝
Very lowi,j,k

The evidence is very uncertain about the effect of FMT on quality‐of‐life scores: IBDQ in UC.

*The risk in the intervention group (and its 95% confidence interval) is based on the assumed risk in the comparison group and the relative effect of the intervention (and its 95% CI).

CI: confidence interval; FMT: fecal microbiota transplantation; IBDQ: Inflammatory Bowel Disease Questionnaire; MD: mean difference; RCT: randomized controlled trial; RR: risk ratio; UC: ulcerative colitis.

GRADE Working Group grades of evidence
High certainty: we are very confident that the true effect lies close to that of the estimate of the effect.
Moderate certainty: we are moderately confident in the effect estimate: the true effect is likely to be close to the estimate of the effect, but there is a possibility that it is substantially different.
Low certainty: our confidence in the effect estimate is limited: the true effect may be substantially different from the estimate of the effect.
Very low certainty: we have very little confidence in the effect estimate: the true effect is likely to be substantially different from the estimate of the effect.

a Downgraded one level due to risk of bias. Three studies were at high risk of bias due to lack of blinding of participants or outcome assessors. Two studies had significant attrition.
b Not downgraded for inconsistency. The direction of effect was in favor of the intervention in eight of 10 studies. I2 = 48%.
c Downgraded one level due to imprecision. We acknowledge that the overall absolute effect was 138 per 1000 or 13.8% higher for FMT, which is clinically meaningful (we considered an absolute effect of 10% to 15% as a minimally important difference); however, the CIs were wide and included an absolute effect as low as 2.3%, which might not be clinically meaningful.
d Downgraded two levels for very serious imprecision because the numbers of events were very small (total 26) and the CIs around the summary estimate were wide. The ratio of upper limit of CI to lower limit of CI exceeded four, indicating that the current pooled sample size is lower than optimal information size.
e Downgraded one level due to imprecision because the CIs around the summary estimate were wide and included a null effect.
f Not downgraded for risk of bias even though one study was at high risk of bias due to lack of allocation concealment and lack of blinding of participants; we considered these factors as less likely to cause significant risk of bias due to the objective nature of the outcome.
g Not downgraded for inconsistency (I2 = 38%).
h Downgraded two levels for very serious imprecision. Overall number of events was small and the CIs around the summary estimate were very wide.
i Not downgraded for risk of bias. Even though one study had high attrition, it was balanced between groups.
j Downgraded one level for inconsistency and I2 = 56%.
k Downgraded two levels for very serious imprecision because the CIs around the summary estimate were very wide and almost included a null effect. In addition, the ratio of upper CI to lower CI exceeded 3, indicating that optimal information size was not achieved.

Figuras y tablas -
Summary of findings 1. Fecal microbiota transplantation compared to control for induction of remission in ulcerative colitis
Summary of findings 2. Fecal microbiota transplantation compared to control for maintenance of remission in ulcerative colitis

Patient or population: people with UC in remission

Setting: inpatient or outpatient

Intervention: FMT

Comparison: control

Outcomes

Anticipated absolute effects* (95% CI)

Relative effect
(95% CI)

№ of participants
(studies)

Certainty of the evidence
(GRADE)

What happens

Risk with control

Risk with FMT

Maintenance of clinical remission in UC (RR > 1 favors intervention)
Follow‐up: 48–56 weeks

556 per 1000

1000 per 1000
(144 to 1000)

RR 2.97
(0.26 to 34.42)

71
(2 RCTs)

⊕⊝⊝⊝
Very lowa,b,c

The evidence is very uncertain about the effect of FMT on maintenance of clinical remission in UC.

Serious adverse events with use of FMT for maintenance of remission in UC (RR > 1 favors control)
Follow‐up: 48–56 weeks

0 per 1000

0 per 1000
(0 to 0)

Not estimable

71
(2 RCTs)

⊕⊝⊝⊝
Very lowd,e

The evidence is very uncertain about the effect of FMT on serious adverse events when FMT was used for maintenance of remission in UC.

Any adverse events with use of FMT for maintenance of remission in UC (RR > 1 favors the control)
Follow‐up: 48–56 weeks

556 per 1000

644 per 1000
(472 to 883)

RR 1.16
(0.85 to 1.59)

71
(2 RCTs)

⊕⊝⊝⊝
Very lowf,g

The evidence is very uncertain about the effect of FMT on any adverse events when FMT was used for maintenance of remission in UC.

Maintenance of endoscopic remission in UC (RR > 1 favors FMT)
Follow‐up: 48–56 weeks

222 per 1000

729 per 1000
(162 to 1000)

RR 3.28
(0.73 to 14.74)

71
(2 RCTs)

⊕⊝⊝⊝
Very lowh,i,j

The evidence is very uncertain about the effect of FMT on maintenance of endoscopic remission in UC.

Quality‐of‐life scores with use of FMT for maintenance of remission in UC
Follow‐up: mean 56 weeks

The mean quality‐of‐life score was 164 in control group when FMT was used for maintenance of remission in UC

MD 38.2 IBDQ score higher
(19.3 higher to 57.1 higher)

10
(1 RCT)

⊕⊝⊝⊝
Very lowh,k

The evidence is very uncertain about the effect of FMT on quality‐of‐life scores when FMT was used for maintenance of remission in UC.

*The risk in the intervention group (and its 95% confidence interval) is based on the assumed risk in the comparison group and the relative effect of the intervention (and its 95% CI).

CI: confidence interval; FMT: fecal microbiota transplantation; IBDQ: Inflammatory Bowel Disease Questionnaire; MD: mean difference; RCT: randomized controlled trial; RR: risk ratio; UC: ulcerative colitis.

GRADE Working Group grades of evidence
High certainty: we are very confident that the true effect lies close to that of the estimate of the effect.
Moderate certainty: we are moderately confident in the effect estimate: the true effect is likely to be close to the estimate of the effect, but there is a possibility that it is substantially different.
Low certainty: our confidence in the effect estimate is limited: the true effect may be substantially different from the estimate of the effect.
Very low certainty: we have very little confidence in the effect estimate: the true effect is likely to be substantially different from the estimate of the effect.

a Downgraded one level for risk of bias. One study addressed induction of clinical remission and maintenance of clinical remission (Haifer 2022). The portion of maintenance of remission was open‐label and there was significant attrition for this portion of the study.
b Downgraded one level for inconsistency. The magnitude of effect differed widely between the two studies. I2 = 72%.
c Downgraded two levels for imprecision. The number of events was small and the CIs around the summary estimate were very wide.
d Downgraded one level for risk of bias. One study was open‐label and had significant attrition when FMT was used for maintenance of remission, so the assessment of risk of serious adverse events could have been biased (Haifer 2022).
e Downgraded two levels for very serious imprecision. There were no events in either study.
f Downgraded one level for risk of bias. One study was open‐label and had significant attrition when FMT was used for maintenance of remission, so the assessment of risk of adverse events could have been biased (Haifer 2022).
g Downgraded two levels for severe imprecision. The CIs around the summary estimate were very wide.
h Downgraded one level for risk of bias. One study was open‐label and had significant attrition when FMT was used for maintenance of endoscopic remission.
i Not downgraded for inconsistency as both studies had an effect in favor of the intervention.
j Downgraded two levels for very serious imprecision. The number of events was small and CIs around the summary estimate were very wide.
k Downgraded two levels for very serious imprecision. There was a low number of participants (10) and the CIs around the summary estimate were very wide.

Figuras y tablas -
Summary of findings 2. Fecal microbiota transplantation compared to control for maintenance of remission in ulcerative colitis
Summary of findings 3. Fecal microbiota transplantation compared to control for induction of remission in Crohn disease

Patient or population: people with active CD

Setting: inpatient or outpatient

Intervention: FMT

Comparison: control

Outcomes

Anticipated absolute effects* (95% CI)

Relative effect
(95% CI)

№ of participants
(studies)

Certainty of the evidence
(GRADE)

What happens

Risk with control

Risk with FMT

Induction of clinical remission in CD

Not estimable

(0 studies)

No study reported data on use of FMT for induction of clinical remission in CD.

Serious adverse events with use of FMT for induction of remission in CD

Not estimable

(0 studies)

No study reported data for serious adverse events when FMT was used for induction of remission in CD.

Any adverse events with use of FMT for induction of remission in CD

Not estimable

(0 studies)

No study reported data for any adverse events when FMT was used for induction of remission in CD.

Induction of endoscopic remission in CD

Not estimable

(0 studies)

No study reported data on use of FMT for induction of endoscopic remission in CD.

Quality‐of‐life scores with use of FMT for induction of remission in CD

Not estimable

(0 studies)

No study reported data for quality‐of‐life scores when FMT was used for induction of remission in CD.

*The risk in the intervention group (and its 95% confidence interval) is based on the assumed risk in the comparison group and the relative effect of the intervention (and its 95% CI).

CD: Crohn disease; CI: confidence interval; FMT: fecal microbiota transplantation; MD: mean difference; RR: risk ratio.

GRADE Working Group grades of evidence
High certainty: we are very confident that the true effect lies close to that of the estimate of the effect.
Moderate certainty: we are moderately confident in the effect estimate: the true effect is likely to be close to the estimate of the effect, but there is a possibility that it is substantially different.
Low certainty: our confidence in the effect estimate is limited: the true effect may be substantially different from the estimate of the effect.
Very low certainty: we have very little confidence in the effect estimate: the true effect is likely to be substantially different from the estimate of the effect.

Figuras y tablas -
Summary of findings 3. Fecal microbiota transplantation compared to control for induction of remission in Crohn disease
Summary of findings 4. Fecal microbiota transplantation compared to control for maintenance of remission in Crohn disease

Patient or population: people with CD in remission

Setting: inpatient or outpatient

Intervention: FMT

Comparison: control

Outcome

Anticipated absolute effects (95% CI)

Relative effect (95% CI)

№ of participants
(studies)

Certainty of the evidence

What happens

Risk with control

Risk with FMT

Maintenance of remission in CD
Follow‐up: 24 weeks

300 per 1000

363 per 1000
(108 to 1000)

RR 1.21
(0.36 to 4.14)

21
(1 RCT)

⊕⊝⊝⊝
Very lowa,b

The evidence is very uncertain about the effect of FMT on maintenance of remission in CD.

Serious adverse events with use of FMT for maintenance of remission in CD
Follow‐up: 24 weeks

Not estimable

(1 RCT)

⊕⊝⊝⊝
Very lowa,b

The evidence is very uncertain about the effect of FMT on serious adverse events in people with CD in remission. The number of events was very small and the data were reported in such a way that an effect size could not be calculated from the only included study for this outcome.

Any adverse events with use of FMT for maintenance of remission in CD
Follow‐up: 24 weeks

Not estimable

(1 RCT)

⊕⊝⊝⊝
Very lowa,b

The evidence is very uncertain about the effect of FMT on any adverse events in people with CD in remission. The number of events was very small and the data were reported in such a way that an effect size could not be calculated from the only included study for this outcome.

Maintenance of endoscopic remission in CD

(0 studies)

No data reported for this outcome.

Quality‐of‐life scoreswith use of FMT for maintenance of remission in CD

(0 studies)

No data reported for this outcome.

*The risk in the intervention group (and its 95% confidence interval) is based on the assumed risk in the comparison group and the relative effect of the intervention (and its 95% CI).

CD: Crohn disease; CI: confidence interval; FMT: fecal microbiota transplantation; RCT: randomized controlled trial; RR: risk ratio.

GRADE Working Group grades of evidence
High certainty: we are very confident that the true effect lies close to that of the estimate of the effect.
Moderate certainty: we are moderately confident in the effect estimate: the true effect is likely to be close to the estimate of the effect, but there is a possibility that it is substantially different.
Low certainty: our confidence in the effect estimate is limited: the true effect may be substantially different from the estimate of the effect.
Very low certainty: we have very little confidence in the effect estimate: the true effect is likely to be substantially different from the estimate of the effect.

a Downgraded one level for risk of bias. The only included study was at high risk of bias due to lack of blinding of outcome assessors and high attrition.
b Downgraded two levels due to imprecision. The number of events was very small and the data were reported in such a way that an effect size could not be calculated from the only included study for this outcome.

Figuras y tablas -
Summary of findings 4. Fecal microbiota transplantation compared to control for maintenance of remission in Crohn disease
Table 1. Microbiome outcomes

Study

Primary disease addressed

Sequencing platform

Alpha diversity

Beta diversity

Notable bacterial taxonomic profiles

Methods and main findings of microbiome analysis

Moayyedi 2015

UC

MiSeq Illumina

Not reported

"Beta diversity (Bray‐Curtis dissimilarity) was calculated using the Phyloseq R package. There was a statistically significant change in microbiota composition with more diversity in the treatment group compared with the placebo group at week 6 vs baseline (P= 0.02, Mann‐Whitney U test)"

"Relative abundance and taxonomic profiles were computed using Quantitative Insights Into Microbial Ecology. Taxonomic profiles of the donors highlighted distinct microbial differences between the 2 most common donors (A and B) used in this study."

 

  • Lachnospiraceae

  • Blautia

  • Faecalibacterium

  • Ruminococcaceae

  • Clostridiaceae

  • Subdoligranulum

  • Bacteroides

  • Prevotella

  • Lachnospira

  • Clostridiales

  • Erysipelotrichaceae

  • Ruminococcaceae

  • Oscillospira

  • Ruminococcus

  • Eubacterium

"The study authors sequenced the V3 region of the 16S rRNA gene using MiSeq Illumina technology. QIIME and the Phyloseq R package was used for curation of data and in‐depth microbiota analyses. This study compared the microbiota of several different donors. Moreover, the authors compared the microbiota of FMT recipients during the time course of the study following FMT. Finally, responders and non‐responders microbiota were compared. Microbiota structure analyses utilizing the Bray‐Curtis dissimilarity metric demonstrated that patients receiving FMT showed a change in their microbiota following FMT. This shift led to microbiota that was more similar to the donor microbiota over time. Moreover, the authors observed a difference in the microbiota between responders and non‐responders. Interestingly, two donors were associated with more successful FMTs and these individuals harbored increased Ruminococcus and Lachnospiraceae and decreased abundance of Streptococci and Escherichia."

Paramsothy 2017

UC

MiSeq Illumina

"Increased α diversity was specific to faecal microbiota transplantation; three patients allocated placebo who met criteria for the primary outcome showed no change in diversity. Faecal microbiota transplantation therapy was associated with a significant increase in α diversity, which was durable 8 weeks after therapy completion. patients achieving the primary outcome seemed to have higher baseline microbial diversity before faecal microbiota transplantation and a greater increase in α diversity with faecal microbiota transplantation."

Not reported

"Several microbial taxa were associated with remission after double‐blind faecal microbiota transplantation (Barnesiella spp, Parabacteroides spp, Clostridium cluster IV, and Ruminococcus spp) and after open‐label faecal microbiota transplantation (Blautia spp, Dorea spp, Ruminococcus, and Clostridium cluster XVIII). Both Fusobacterium spp and Sutterella spp were associated consistently with no remission in patients who had double‐blind and open‐label faecal microbiota transplantation."

"The study sequenced the V1 through V3 region of 16S rRNA gene using MiSeq Illumina technology. Microbiota analysis and curation were performed utilizing mothur, and altered members of the microbiota were identified using the biomarker discovery algorithm linear discriminant analysis Effect Size (LEfSe). Shotgun metagenomics sequencing was also performed in subsequent follow‐up studies. The authors performed RNA extraction to ensure that bacteria detected in their analyses were live and active bacteria. Microbiota analyses were done on 70 patients (314 fecal samples) and 113 donor fecal samples; 55 individual donors were used and 58 batched donor samples. The microbiota of donors was analyzed along with patients receiving individual or batched dFMTs. For recipients, the microbiota composition was analyzed prior to and following FMT, and patients were binned into responders and non‐responders. The microbiota of batched donor samples showed higher phylogenetic diversity than individual donors, and overall donor samples had higher diversity than baseline samples from patients with IBD. After four and eight weeks, patients receiving FMT saw an increase in phylogenetic diversity in the microbiota compared to baseline. LEfSe analysis determined that 295 microbial taxa were differentially altered following transplant and 78 of these members showed high linear discriminant analysis scores (>3). Interestingly, regardless of clinical outcome, the authors observed decreased abundance of operational taxonomic units (OTUs) affiliated with the Bacteroides genera and increased abundance of OTUs affiliated with the Prevotella genera. The authors further describe that FMT was associated with increased diversity in all patients. Importantly, recipients who achieved a successful primary outcome had greater richness in OTUs at baseline, during fecal microbiota transplantation and at 8 weeks. Finally, the authors performed LEfSe analysis comparing patients who responded to non‐responders; 87 Taxa were associated with primary outcomes in masked patients and 46 were associated with open‐label patients. Remission was associated with taxa with Barnsiella, Parabacteroides, Clostridium cluster IV and Ruminococcus. Moreover, Fusobacterium and Sutterella were associated with a lack of remission in all patients."

Rossen 2015

UC

Human Intestinal Tract chip (HITchip) phylogenetic microarray

"At 12 weeks after treatment, 16 samples were available from FMT‐D patients and 18 FMT‐A patients. The diversity index of responders in both groups increased significantly (from S = 5.61 ± 0.29 to S = 5.83 ± 0.15 in responders to FMT‐D (P = .06) and from S = 5.81 ± 0.07 to S = 6.03 ± 0.14 in responders to FMT‐A (P = .01)). The increase in diversity at week 12 could be attributed to an increase in both richness and evenness in all responders. Diversity in nonresponders did not change over time."

Not reported

"Redundancy analysis showed that the microbiota composition of responders in the FMT‐D group shifted from overlap with nonresponders at baseline to healthy donors at week 12. This shift was mainly explained by a regain of Clostridium clusters IV, XIVa, and XVIII, and reduction in Bacteroidetes. Notably, changes in Faecalibacterium prausnitzii (from 8.00 ± 5.72 at baseline to 8.37 ± 5.10 at week 12; P = .68), which belongs to Clostridium cluster IV, did not play a role in this increased abundances in our study subjects. Responders to FMT‐A shifted away from nonresponders, but in a different direction than responders to FMT‐D. This shift was mostly associated with an increase in abundance of Bacilli, Proteobacteria, and Bacteriodetes."

"The study used the Human Intestinal Tract chip (HITchip) phylogenetic microarray, to perform microbiome diversity analysis. The study compared microbiota profiles of donors and patients with UC. Moreover, this study characterized microbiota profiles prior to and following FMT with donor stool or FMT with autologous stool. Finally, responders and non‐responders for each FMT group were compared. Microbiome analysis with HITchip showed that microbiota profiles and diversity indexes of patients with UC was different than healthy donors. This was highlighted by enrichment in taxa belonging to the Bacteroidetes, Proteobacteria, Bacilli, and Clostridium clusters IX and XI and decreased levels of Clostridium IV, IXIVa, and XVIII compared to donors." "Following FMT with both donor stool and autologous stool, diversity increased in responders and did not increase in non‐responders. Shifts in the community taxa of responders could be observed in both donor and autologous FMTs. However, the shift between these two responder groups was distinct. Microbiota of FMT responders from donors were highlighted by increases in taxa belonging to the Clostridium IV, XIVa, and IVIII groups. Alternatively, the microbiota of responders that received autologous FMT was highlighted by an increase in Bacilli, Proteobacteria, and Bacteroidetes. Correlation analysis further revealed that microbiota of responding recipients showed increased similarity to donor microbiota following FMT. Importantly, no shifts in microbiota were observed in non‐responders."

Costello 2019

UC

Not reported

Not reported

Not reported

Association with increased abundance following dFMT:

  • Peptococcus niger

  • Faecalicoccus pleomorphus

  • Olsenella sp.

  • Acidaminococcus intestini

  • Senegalimassilia anaerobia

  • Prevotella copri

  • Methanobrevibacter smithii

  • Clostridium methylpentosum

  • Alistipesindistinctus

  • Slackia isoflavoniconvertens

  • Odoribacter splanchnicus

Association with reduced abundance following dFMT:

  • Anaerostipescaccae

  • Gordonibacter pamelaeae

  • Clostridium aldenense

Studied changes in fecal‐associated microbiota following FMT by 16S ribosomal RNA sequencing, stratified by both change in total Mayo score following FMT and randomization. The durability of engraftment of these species acquired following dFMT was assessed by quantifying these species at 12 months. The V4 hypervariable region of the 16S ribosomal RNA gene was amplified and raw sequencing data processed into operational taxonomic units at 97% similarity in stool samples from individual donors, pooled stool batches, and FMT recipients taken at weeks 0, 4, 8, and 52.

At baseline, blended donor stool showed the most microbial diversity (measured by operational taxonomic units) followed by individual donor stool then stool of patients with UC. Diversity increased following dFMT compared with aFMT at weeks 4 and 8. There was no significant association between change in total Mayo score following dFMT and baseline diversity (β = 0.6 [95% CI, −4.8 to 5.9]; P= .84) nor change in diversity at week 8 (β = −20.3 [95% CI, −50.7 to 11.2]; P = .23).

The 10 bacteria and the archaea Methanobrevibacter smithii whose increased abundance were most strongly associated with dFMT at weeks 4 and 8 were all anaerobic. The abundance of these organisms remained relatively stable from weeks 4 to 8; however, by 12 months, there was variability in abundance of many of these organisms. Increased abundance of Anaerofilum pentosovorans and Bacteroides coprophilus species was strongly associated with disease improvement following dFMT.

Crothers 2021

UC

MoBio Powersoil 96 kit

"Measures of microbial alpha

diversity (Shannon index) between subjects and donor samples, and to their own baseline samples, were calculated.

No difference in alpha diversity was observed between treatment groups at baseline. FMT did not increase alpha (Shannon) diversity in recipients but did lead to community‐level changes in the gut microbiota creating measurable similarity (beta diversity, Jensen‐Shannon divergence index) between FMT subjects and their donor."

"Measures of microbial beta diversity (Jensen‐
Shannon divergence) between subjects and donor samples, and to their own baseline samples, were calculated.

No difference in beta diversity was observed between treatment groups at baseline. FMT did not increase alpha (Shannon) diversity in recipients but did lead to community‐level changes in the gut microbiota creating measurable similarity (beta diversity, Jensen‐Shannon divergence index) between FMT subjects and their donor."

"Across all time points, stool samples were dominated at the phylum level by Firmicutes, and Bacteroidetes, which accounted for 88.90% of all sequence reads. Bacteria present at lower proportions included Proteobacteria, and Actinobacteria, accounting for 6.9% and 4.0% of total reads, respectively. At the genus level, samples were dominated by Clostridiales and Bacteroidales, with

a lower proportion of Burkholderiales, Bifdobacteriales, Selenomonadlaes, Enterobacteriales, Lactobacillales observed at various time points."

DNA extraction was performed using the MoBio Powersoil 96 kit with minor modifications and 16S rRNA gene libraries targeting the V4 region of the 16S rRNA gene were prepared. Each sample was given a unique reverse barcode and replicates were then pooled, cleaned and normalized prior to sequencing on an Illumina MiSeq 300. Raw sequence reads were then processed and OTU calling performed using the Qiime2—dada pipeline. Measures of microbial alpha diversity (Shannon index) and beta diversity (JensenShannon divergence) between subjects and donor samples, and to their own baseline samples, were calculated.

No difference in alpha or beta diversity was observed between treatment groups at baseline. FMT did not increase alpha (Shannon) diversity in recipients but did lead to community‐level changes in the gut microbiota creating measurable similarity (beta diversity, JensenShannon divergence index) between FMT subjects and their donor. This convergence, which we termed ‘Donor Divergence Index’, remained statistically significant through 8 weeks of dosing weeks following cessation of oral cFMT therapy

Fang 2021

UC

Illumina MiSeq

"Alpha diversity index calculation was performed with abundance indexes (Chao1 and ACE) and diversity indexes (Shannon and Simpson). The

alpha diversity index of the fecal microbiota in active UC

patients, healthy donors and patients after FMT treatment showed no significant difference."

"The beta

diversity of the samples was measured using the Bray‐
Curis distance based on an evenly rarefied OTU abundance table. Statistical differences in measured β‐diversity metrics across groups were

determined using PERMANOVA with 999 permutations,
using adonis in the R package vegan. Shared OTUs were

calculated and visualized using the R package Venn diagram.

To measure the level of similarity between gut microbial

communities, analysis of similarities (ANOSIM) was performed. The data revealed an apparent separation in the structure of the gut microbiota in each group. Principal coordinate analysis (PCoA) was used to
indicate the similarity of the microbiota composition

among samples. PCoA revealed that the gut microbiota in people with UC significantly deviated from that in healthy donors. Treatment with FMT improved the
distance markedly, and the samples clustered tightly
together, showing a trend similar to that of their related
donors, but did not return to the level of healthy donors."

"The taxonomic profiles

showed that the phyla Bacteroidetes, Firmicutes and Proteobacteria were dominant bacteria in the fecal microbiota of healthy donors and active UC patients. The relative abundance of Bacteroidetes was significantly decreased and that of Proteobacteria was significantly increased in active UC patients. Firmicutes showed no significant changes among healthy donors and active UC patients. Compared with healthy donors, patients with active UC showed an increased ratio of Firmicutes and Bacteroidetes. Single fresh FMT could significantly reconstruct the dysbiotic gut microbiota and maintain stability, with an increased proportion of Bacteroidetes and a decreased proportion of Proteobacteria. At the genus level, some specific bacterial biomarkers were identified. The relative abundance of Escherichia was significantly increased in active UC patients and was significantly decreased after FMT. A high abundance of Prevotella was found in the donor gut. FMT‐treated patients who achieved remission also tended to have a higher abundance of Prevotella.

Taxonomic phylum profiles of the gut microbiota among healthy donors, active UC patients and patients
post‐FMT treatment:

  • Bacteroidetes

  • Firmicute

  • Proteobacteria

Prevotella was the dominant genus in the gut microbiota of the healthy donors, and the relative abundance of Prevotella increased after FMT treatment in active UC patients"

"The gut microbiota was assessed by 16S ribosomal RNA sequencing. The V3–V4 hypervariable region of the 16S rRNA gene was amplified via high‐throughput sequencing on the Illumina MiSeq platform, and the raw sequencing data from stool samples from individual donors and FMT recipients pre‐ and post‐FMT treatment were processed into operational taxonomic units at 97% similarity."

"The alpha diversity index of the fecal microbiota in active UC patients, healthy donors and patients after FMT treatment showed no significant difference.

Principal coordinate analysis (PCoA) was used to indicate the similarity of the microbiota composition among samples. PCoA revealed that the gut microbiota in UC patients significantly deviated from that in healthy donors. Treatment with FMT improved the distance markedly, and the samples clustered tightly together, showing a trend similar to that of their related donors, but did not return to the level of healthy donors. The system clustering tree also indicated that a significant difference existed between UC patients and healthy donors.

Linear discriminant analysis effect size (LEfSe) was used to identify differential microorganism communities between groups. The taxonomic profiles showed that the phyla Bacteroidetes, Firmicutes and Proteobacteria were dominant bacteria in the fecal microbiota of healthy donors and active UC patients. The relative abundance of Bacteroidetes was significantly decreased and that of Proteobacteria was significantly increased in people with active UC patients. Firmicutes showed no significant changes among healthy donors and active UC patients. Compared with healthy donors, patients with active UC showed an increased ratio of Firmicutes and Bacteroidetes. Single fresh FMT could significantly reconstruct the dysbiotic gut microbiota and maintain stability, with an increased proportion of Bacteroidetes and a decreased proportion of Proteobacteria. At the genus level, some specific bacterial biomarker were identified. The relative abundance of Escherichia was significantly increased in active UC patients and was significantly decreased after FMT. A high abundance of Prevotella was found in the donor gut. FMT‐treated patients who achieved remission also tended to have a higher abundance of Prevotella."

"The PICRUSt tool was used to predict the functional profiles of gut microbiota with the predicted metagenome, and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway functions were categorized using PICRUSt. PICRUSt predicted analyses found that the gut microbiota pathway functions showed that several pathways in gut microbiome among the donor and pre and post FMT treatment changed significantly, especially the pathways of pyruvate metabolism, sulfur metabolism, pantothenate and CoA biosynthesis, glyoxylate and dicarboxylate metabolism, synthesis and degradation of ketone bodies and other transporters were significantly different between the groups."

Pai 2021

UC

Not reported

Not reported

"Beta‐Diversity trended higher from baseline to week 6 in FMT vs placebo arms"

"Several bacterial taxa were associated with achieving the composite clinical outcome after multiple test correction, including Alistipes spp and Escherichia spp"

"Microbial community profiling in fecal samples was performed centrally at McMaster Children's Hospital. We extracted genomic DNA from patient and donor stool samples using a protocol previously described"

"Beta‐Diversity trended higher from baseline to week 6 in FMT vs placebo arms. Several bacterial taxa were associated with achieving the composite clinical outcome after multiple test correction, including Alistipes spp and Escherichia spp"

Březina 2021

UC

Ion Torrent PGM platform with an Ion 316 Chip Kit v2 BC using an Ion PGM Hi‐Q View Sequencing Kit (ThermoFisher Scientific)

"The analysis of bacterial diversity was assessed through alpha diversity (Chao1, evenness,
Faith's phylogenetic diversity, and Shannon index)." "Alpha diversity, which evaluates the species richness and evenness; Faith's phylogenetic distance; and Shannon diversity showed no significant differences between the FMT and 5‐ASA treatment groups, nor between the responder and non‐responder subgroups inside each cohort."

"The analysis of bacterial diversity was assessed through beta diversity (Jaccard's distance metric) using
the Qiime2 pipeline." "Beta diversity, which evaluates the similarity of bacterial communities among samples,
was assessed using Jaccard's non‐phylogenetic distance matrix. As early as 2 weeks after the therapy initiation, the authors could differentiate responders from non‐responders in both the FMT group
(PERMANOVA p = 0.001, PERMDISP p = 0.100) and 5‐ASA group (PERMANOVA p = 0.003,
PERMDISP p = 0.099)."

"In total, 9 phyla, 142 genera, and 184 species were detected in the samples of UC patients. Firmicutes (41–94%) were detected as the dominant phylum in all samples, regardless of treatment, except for one sample (19%) from the FMT group at the baseline, in which Proteobacteria (52%) were flourishing. The second most abundant were Actinobacteria (1–38%), and/or Bacteroidetes (1–37%). Firmicutes were mainly represented by the order Clostridiales; Bacteroidetes were mainly represented by the order Bacteroidales; and in Actinobacteria, the order Bifidobacteriales predominated. Other phyla including Fusobacteria, Tennericutes, Acidobacteria, Planctomyceles, and TM7 were detected with low frequencies (≤0.4%). The donor stool was dominated by Firmicutes, with a prevalence of the families Lachnospiraceae (67%) and Ruminococcaceae (17%). The relative abundance of Actinobacteria (1%) and Bacteroidetes (2%) was quite low, represented by the family Coriobacteriaceae and the families Prevotellaceae and Bacteroidaceae, respectively. F. prausnitzii was present with a frequency of 3% in the stool of the donor."

"The amplification of the bacterial variable V4‐V5 region of 16S rRNA was performed according to Fliegerova et al using EliZyme HS Robust MIX Red (Elisabeth Pharmacon) and 10 µM of each primer (forward: GGATTAGATACCCTGGTAGT, reverse: CACGACACGAGCTGACG). The thermal cycling conditions included initial denaturation for 10 min at 95 ◦C followed by 30 cycles of 30 s at 95 ◦C, 30 s at 57 ◦C, and 30 s at 72 ◦C. PCR amplicons (≈300 bp [base pairs]) were purified and libraries were prepared using the NEBNext Fast DNA Library Prep Set for Ion Torrent (New England BioLabs) and Ion Xpress Barcode Adapters 1–96 Kit (ThermoFisher Scientific). Libraries were consequently pooled, with their equimolar concentration determined with a KAPA Library Quantification Kit (KAPA Biosystems). The sequencing template was prepared in a One Touch 2 instrument using an Ion PGM OT2 HiQ View Kit (ThermoFisher Scientific). HTS was performed in an Ion Torrent PGM platform with an Ion 316 Chip Kit v2 BC (ThermoFisher Scientific) using an Ion PGM Hi‐Q View Sequencing Kit (ThermoFisher Scientific), according to the manufacturer's protocols"

"A non‐significant increase was detected in Shannon diversity index, for both responders and non‐responders, 2 weeks after both therapy types compared to the baseline (Figure S2). A higher Shannon index was still observed when more samples from different sampling points after therapy initiation were included in the calculation, indicating that FMT and 5‐ASA can, to a certain extent, influence the microbial alpha diversity of UC patients."

Sarbagili Shabat 2022

UC

Next‐generation sequencing libraries were prepared

using Nextera DNA library prep [Illumina] and sequenced on a
NovaSeq sequencing platform [Illumina]

Did not detect any postdiet microbial shift in alpha diversity in FMT donors.

Not reported

Not reported

The authors performed donor microbiome analysis following and did not report on the recipient's. "Metagenomic DNA was purified using DNeasy PowerMag Soil DNA extraction kit [Qiagen] optimised for Tecan automated platform. Next‐generation sequencing [NGS] libraries were prepared using Nextera DNA library prep [Illumina] and sequenced on a NovaSeq sequencing platform [Illumina]. Sequencing was performed with 75‐bp single‐end reads with the depth of 10 million reads per sample. We filtered metagenomic reads containing Illumina adapters, filtered low quality reads, and trimmed low‐quality read edges. We detected host DNA by mapping with Bowtie to the human genome with inclusive parameters, and removed those reads. Bacterial relative abundance [RA] estimation was performed by mapping bacterial reads to species‐level genome bins [SGB] representative genomes. We selected all SGB representatives with at least 5 genomes in a group, and for these representatives' genomes kept only unique regions as a reference dataset. Mapping was performed using Bowtie and abundance was estimated by calculating the mean coverage of unique genomic regions across the 50% most densely covered areas. Bacterial richness declined in 5/7 donors examined. They did not detect any post‐diet microbial shift, including in alpha diversity."

Sokol 2020

CD

MiSeq Illumina

"The authors observed a significant increase in alpha diversity following FMT but not sham"

"The similarity of the fecal microbiota samples was assessed using the Sorensen similarity index (Sorensen similarity index = [1 – Bray Curtis dissimilarity index])." "No statistically significant difference was observed between the FMT and sham group at week 6."

"The authors identified several taxa associated with flare, including many taxa belonging to the Gammaproteobacteria class and the Clostridiales order comprising Ruminococcus gnavus. In addition, we also observed taxa associated with maintenance of remission, such as Ruminococcaceae, Coprococcus, and Desulfovibrio genus."

"The similarity of the fecal microbiota samples was assessed using the Sorensen similarity index (Sorensen similarity index = [1 – Bray Curtis dissimilarity index])"

"We observed a significant increase in alpha diversity following FMT but not sham"

"We then looked at the similarity between donor and recipient microbiota using the Sorensen index. No statistically significant difference was observed between the FMT and sham group at week 6."

aFMT: autologous fecal microbiota transplantation; CD: Crohn disease; CRP: C‐reactive protein; dFMT: donor fecal microbiota transplantation; EQ‐5D: EuroQol Five‐Dimensions Questionnaire; ESR: erythrocyte sedimentation rate; FMT: fecal microbiota transplantation; IBDQ: Inflammatory Bowel Disease Questionnaire; SCCAI: Simple Clinical Colitis Activity Index; UC: ulcerative colitis.

Figuras y tablas -
Table 1. Microbiome outcomes
Comparison 1. Fecal microbiota transplantation (FMT) versus control for induction of remission in ulcerative colitis (UC)

Outcome or subgroup title

No. of studies

No. of participants

Statistical method

Effect size

1.1 Induction of clinical remission in UC at longest follow‐up Show forest plot

10

468

Risk Ratio (M‐H, Random, 95% CI)

1.79 [1.13, 2.84]

1.2 Induction of clinical remission in UC at 8 weeks Show forest plot

8

408

Risk Ratio (M‐H, Random, 95% CI)

1.68 [0.93, 3.05]

1.3 Induction of clinical remission in UC at 12 weeks Show forest plot

3

108

Risk Ratio (M‐H, Random, 95% CI)

1.54 [0.89, 2.66]

1.4 Induction of clinical remission in UC at longest follow‐up: subgroup analysis by route of administration Show forest plot

10

468

Risk Ratio (M‐H, Random, 95% CI)

1.79 [1.13, 2.84]

1.4.1 Upper gastrointestinal

2

83

Risk Ratio (M‐H, Random, 95% CI)

2.22 [0.97, 5.07]

1.4.2 Lower gastrointestinal

7

370

Risk Ratio (M‐H, Random, 95% CI)

1.65 [0.93, 2.92]

1.4.3 Mixed (upper and lower) route

1

15

Risk Ratio (M‐H, Random, 95% CI)

5.62 [0.31, 100.52]

1.5 Induction of clinical remission in UC at longest follow‐up: subgroup analysis by type of donor Show forest plot

10

468

Risk Ratio (M‐H, Random, 95% CI)

1.79 [1.13, 2.84]

1.5.1 Single donor

6

191

Risk Ratio (M‐H, Random, 95% CI)

1.37 [0.76, 2.48]

1.5.2 Multiple donors

4

277

Risk Ratio (M‐H, Random, 95% CI)

2.77 [1.54, 4.98]

1.6 Induction of clinical remission in UC at longest follow‐up: subgroup analysis by age Show forest plot

10

468

Risk Ratio (M‐H, Random, 95% CI)

1.79 [1.13, 2.84]

1.6.1 Children

1

25

Risk Ratio (M‐H, Random, 95% CI)

0.92 [0.29, 2.89]

1.6.2 Adults

9

443

Risk Ratio (M‐H, Random, 95% CI)

1.93 [1.17, 3.17]

1.7 Induction of clinical remission in UC at longest follow‐up: subgroup analysis by frequency of FMT Show forest plot

10

468

Risk Ratio (M‐H, Random, 95% CI)

1.79 [1.13, 2.84]

1.7.1 Single infusion

1

20

Risk Ratio (M‐H, Random, 95% CI)

1.80 [0.94, 3.46]

1.7.2 Multiple infusions

9

448

Risk Ratio (M‐H, Random, 95% CI)

1.83 [1.05, 3.18]

1.8 Induction of clinical remission in UC at longest follow‐up: sensitivity analysis using fixed‐effect model Show forest plot

10

468

Risk Ratio (M‐H, Fixed, 95% CI)

1.88 [1.37, 2.57]

1.9 Induction of clinical remission in UC at longest follow‐up: sensitivity analysis for available cases Show forest plot

10

382

Risk Ratio (M‐H, Random, 95% CI)

1.77 [1.07, 2.94]

1.10 Induction of clinical remission in UC at longest follow‐up: composite of clinical score and endoscopic score Show forest plot

8

392

Risk Ratio (M‐H, Random, 95% CI)

2.13 [1.51, 3.02]

1.11 Serious adverse events for induction of remission in UC Show forest plot

10

468

Risk Ratio (M‐H, Random, 95% CI)

1.77 [0.88, 3.55]

1.12 Serious adverse events for induction of remission in UC: subgroup analysis by route of administration Show forest plot

10

468

Risk Ratio (M‐H, Random, 95% CI)

1.77 [0.88, 3.55]

1.12.1 Upper gastrointestinal

2

83

Risk Ratio (M‐H, Random, 95% CI)

1.21 [0.32, 4.49]

1.12.2 Lower gastrointestinal

7

370

Risk Ratio (M‐H, Random, 95% CI)

2.19 [0.92, 5.23]

1.12.3 Mixed (upper and lower) route

1

15

Risk Ratio (M‐H, Random, 95% CI)

1.14 [0.09, 15.08]

1.13 Serious adverse events for induction of remission in UC: subgroup analysis by type of donor Show forest plot

10

468

Risk Ratio (M‐H, Random, 95% CI)

1.77 [0.88, 3.55]

1.13.1 Single donor

6

191

Risk Ratio (M‐H, Random, 95% CI)

2.36 [0.83, 6.69]

1.13.2 Multiple donors

4

277

Risk Ratio (M‐H, Random, 95% CI)

1.40 [0.55, 3.58]

1.14 Serious adverse events for induction of remission in UC: subgroup analysis by age Show forest plot

10

468

Risk Ratio (M‐H, Random, 95% CI)

1.77 [0.88, 3.55]

1.14.1 Children

1

25

Risk Ratio (M‐H, Random, 95% CI)

4.62 [0.63, 34.05]

1.14.2 Adults

9

443

Risk Ratio (M‐H, Random, 95% CI)

1.55 [0.73, 3.26]

1.15 Serious adverse events for induction of remission in UC: sensitivity analysis using fixed‐effect model Show forest plot

10

468

Risk Ratio (M‐H, Fixed, 95% CI)

1.87 [0.95, 3.68]

1.16 Serious adverse events for induction of remission in UC: sensitivity analysis for available cases Show forest plot

10

382

Risk Ratio (M‐H, Random, 95% CI)

1.74 [0.88, 3.47]

1.17 Any adverse events for induction of remission in UC Show forest plot

9

417

Risk Ratio (M‐H, Random, 95% CI)

0.99 [0.85, 1.16]

1.18 Induction of endoscopic remission in UC at longest follow‐up Show forest plot

5

285

Risk Ratio (M‐H, Random, 95% CI)

1.45 [0.64, 3.29]

1.19 Quality of life (Inflammatory Bowel Disease Questionnaire [IBDQ]) scores at longest follow‐up for induction of remission in UC Show forest plot

3

131

Mean Difference (IV, Random, 95% CI)

15.34 [‐3.84, 34.52]

1.20 Quality of life (IBDQ) scores at longest follow‐up for induction of remission in UC: sensitivity analysis without Haifer 2022 Show forest plot

2

96

Mean Difference (IV, Random, 95% CI)

22.20 [0.63, 43.78]

1.21 Induction of clinical response in UC at longest follow‐up Show forest plot

10

468

Risk Ratio (M‐H, Random, 95% CI)

1.33 [0.96, 1.84]

1.22 Induction of endoscopic response in UC at longest follow‐up Show forest plot

3

164

Risk Ratio (M‐H, Random, 95% CI)

1.48 [0.79, 2.76]

1.23 Withdrawals in studies on induction of remission in UC Show forest plot

10

468

Risk Ratio (M‐H, Random, 95% CI)

0.91 [0.62, 1.34]

1.24 Erythrocyte sedimentation rate (ESR) at longest follow‐up for induction of remission in UC (mm/hour) Show forest plot

2

113

Mean Difference (IV, Random, 95% CI)

2.98 [‐0.38, 6.34]

1.25 ESR at longest follow‐up for induction of remission in UC: sensitivity analysis without Moayyedi 2015 (mm/hour) Show forest plot

1

81

Mean Difference (IV, Random, 95% CI)

3.00 [‐0.56, 6.56]

1.26 C‐reactive protein (CRP) at longest follow‐up for induction of remission in UC (mg/L) Show forest plot

3

128

Mean Difference (IV, Random, 95% CI)

1.11 [‐1.85, 4.08]

1.27 CRP at longest follow‐up for induction of remission in UC: sensitivity analysis without Moayyedi 2015 (mg/L) Show forest plot

2

96

Mean Difference (IV, Random, 95% CI)

‐0.44 [‐6.52, 5.64]

1.28 Fecal calprotectin at longest follow‐up for induction of remission in UC (μg/mg) Show forest plot

3

131

Mean Difference (IV, Random, 95% CI)

‐69.49 [‐260.62, 121.65]

Figuras y tablas -
Comparison 1. Fecal microbiota transplantation (FMT) versus control for induction of remission in ulcerative colitis (UC)
Comparison 2. Fecal microbiota transplantation (FMT) versus control for maintenance of remission in ulcerative colitis (UC)

Outcome or subgroup title

No. of studies

No. of participants

Statistical method

Effect size

2.1 Maintenance of clinical remission in UC Show forest plot

2

71

Risk Ratio (M‐H, Random, 95% CI)

2.97 [0.26, 34.42]

2.2 Maintenance of clinical remission in UC: sensitivity analysis using fixed‐effect model Show forest plot

2

71

Risk Ratio (M‐H, Fixed, 95% CI)

1.53 [1.13, 2.07]

2.3 Maintenance of clinical remission in UC: sensitivity analysis for available cases Show forest plot

2

64

Risk Ratio (M‐H, Random, 95% CI)

1.66 [0.47, 5.81]

2.4 Serious adverse events for maintenance of remission in UC Show forest plot

2

0

Risk Ratio (M‐H, Random, 95% CI)

Not estimable

2.5 Any adverse events for maintenance of remission in UC Show forest plot

2

71

Risk Ratio (M‐H, Random, 95% CI)

1.16 [0.85, 1.59]

2.6 Maintenance of endoscopic remission in UC Show forest plot

2

71

Risk Ratio (M‐H, Random, 95% CI)

3.28 [0.73, 14.74]

2.7 Withdrawals in studies on maintenance of remission in UC Show forest plot

2

71

Risk Ratio (M‐H, Random, 95% CI)

0.30 [0.05, 1.73]

2.8 Erythrocyte sedimentation rate (ESR) at longest follow‐up for maintenance of remission in UC (mm/hour) Show forest plot

1

61

Mean Difference (IV, Random, 95% CI)

‐10.40 [‐12.54, ‐8.26]

2.9 C‐reactive protein (CRP) at longest follow‐up for maintenance of remission in UC (mg/L) Show forest plot

1

61

Mean Difference (IV, Random, 95% CI)

‐2.70 [‐3.82, ‐1.58]

Figuras y tablas -
Comparison 2. Fecal microbiota transplantation (FMT) versus control for maintenance of remission in ulcerative colitis (UC)
Comparison 4. Fecal microbiota transplantation (FMT) versus control for maintenance of remission in Crohn's disease (CD)

Outcome or subgroup title

No. of studies

No. of participants

Statistical method

Effect size

4.1 Maintenance of clinical remission in CD Show forest plot

1

21

Risk Ratio (M‐H, Fixed, 95% CI)

1.21 [0.36, 4.14]

4.2 Withdrawals in studies on maintenance of remission in CD Show forest plot

1

21

Risk Ratio (M‐H, Fixed, 95% CI)

1.36 [0.54, 3.46]

Figuras y tablas -
Comparison 4. Fecal microbiota transplantation (FMT) versus control for maintenance of remission in Crohn's disease (CD)